%PDF-1.3 % 4 0 obj << /Length 5 0 R /Filter /FlateDecode >> stream xisFzS)P^{mYMhwET%'Y;yf0\IW7_vs84tw; CowC?X/m/usM7ؽ~alm~؃ <Ca/0 -2 \4z=^/u7.|6=,%:K>|m~!.Dal6}G)9uxUۍH,x5C.^u1D S$fMɭ`4 )k*nߣC_{>9?Ï^,4nx?$= )neO0 kѽ-tգy@*ێon-nۖR2͙i;-r\ڥXX~~3h]/eۣ~}gm7[46'l(^g.gusq3ۋusZ?3%u}G,G/kCLͻErs}Ӫ W\@H ϩBhKuDh$ikÛI*iB5 hX$AU`g1ˡf0'T8O U} "b?tF ^\nܴ.,G;71;^,Q5VE6hQ s̤eaT) b1g @Ja& C({<؈x/]iVk޺k$d2i4H5BHM7ۈSo z8;)6}  .#'87]|B5cO*Z=(8CkutAzA{ Z0W3~h:NSki7C{`Eɒ o. 0@k؞<9-Nuz< C>nð{nY{zӠG}5mJ\KK(O$ 渎lr^y5׺~v_o]9-,9*6z$bAcDc)pX"KRGCc0D @mpelJSg;A̭/g%X/1FLA7T}1 UJXZ9zݲ1Uی 7o! {}%wWvZj Ň^YGֶǷN,l n܋o45Cs?[PajÏK1]=>)e ܞ ӱe-. o?n[/ϦN7#g.Ťv #;y@d -O-;O^n dߓ '`BV$)~/ydS*9 ~dY}HL jX%DJ2MI&MVCU֐h̴D .!apιg{~&&^TKE򫯿%*~@JZ շ}{<'q$vԸ\晁d.xPʲ ,#;pa'CGN')*&N!`#xI&d=3Cph(hOjB, 3 :C69mh^+˹$hB4l޹`Q I8Ofu1!dO&ԓVL1Q& 2s* jV1P ykNENz(ӳV1) ABwNP4JR%߅@'#VńVA[#_6Z^Çw)|.0 )6 U?;<>#w%"v<;H aH VM >M-)u6(( 5kFRIܝK.U=1sO,s%W[ꣂޖ9_*Oq-\,Sr0pp{FᯌlR98~R曮%ZHEc yvݱvj; B46G9yzA1 K}ni-BA8O^Lm~[,A9 峃 F5)?v QkšMeQ *8'Γwlt9ovzȞeinu:DAoU' c i”pg5AV]2mq'Viw䩹L%]afcgQ孕|dTpQn,`B16DJ!BZ3FJ"XۂlX C1"kS(R')QzYΑfM $=G}MӧRBpwks|3s:\}˰-뻅)TAE=~ <'mvybԂ`&#@hRDޟ5`Ew=ok a-1`j;@d+'EղUUXq&Cc%)Xp'sP+|D7ej+ Wi#gpҽLops[&HjY9C:^+#+W'.fn<2cTʽKdcjd1KP3Ę69m!A>Z;#fi7þA OJpVJ,dN;#c*CpD ] #/ܛ7xa*a{bq'k"<8> 7Eeɀܦ) WQˤ&,ǟTdD 50I5ʹ2:ązAx rkzg80ϱ`=47iXBA;Fl盬 *{QjBIdfzJ~Z %t-+W86P"=TީP\"s@4*5h:à o=VI#*ppY#|) yb;p:KHeՈ6Icw.ggGX1Rኑ-ކhۇ8vl^ž*uHK.Y O1ҶCAĖؗbX Lm=slAh'_x:-q/lcl'[\J,6:ZKQFҶ,cCSZw,y8 sp9o=͍¯Hr|o޽.oԛ 7n^^4֛?6$›}Yb6QYS6a`~f@tj% 'p/E#_rHӇ!&Rû [M -_/SW؟l-܇*iDʧ| 8cbH{-wsut)%㰟ÓٛCDo: )%;,J Rw}wJჵĨu-63C:O8ޘ`8 'cGPK ExQs,+6N1ϔ'K {9e1H8F_(XYkvL[xe C`)RRQ N,:$[Lŧ|IbgxwLQ T`,Z@&mMVqű7cp44XUL %Ap< 4,WK $EmҔ>7)hrGHu205̠b ,iseGp]"&'v"dghÎ;' A&:4O3n]lӃC,_A#VM.b@j _vhnJ<(aE'p8mFɆbJ,]|0|# PnR1)up\Ɠ%pΪh?ʟcֲ>wpv\a\SND{62+ ɲŴm@d-fRPI=_b3x(G6k?9nNܗKvky`bVJm4`f@"M 4 |d%֍ 8ju{Ɲ264lC߄u0luvg:9'q hCP4]ENoJHh)Ʌh63~ ,,trV_:8dN5 -U.?U=%K_ny §j#q&:4ӒMf>LŜjPϐb:_z$$QH>P2v~8f#gjm.|EL |$-l*!ǰ$oq\Y;<҃ ψ&˂'3\I5|q/F"4J=ŝ'l+@ptRL" /߀.@d"hӶAQ&C?0! !'bNjcpZʸ*Ѷbg`CIy?ψs/ ;fww Vk0}PEt۾(=ZW1p,x p88hH"$#i8SD]ѕ>&"q8==S[qb#_)H+,+1J\mna%@ ~yQqf\ endstream endobj 5 0 obj 7422 endobj 2 0 obj << /Type /Page /Parent 3 0 R /Resources 6 0 R /Contents 4 0 R /MediaBox [0 0 595.2756 841.8898] >> endobj 6 0 obj << /ProcSet [ /PDF /Text /ImageB /ImageC /ImageI ] /ColorSpace << /Cs1 7 0 R >> /Font << /TT1 8 0 R /TT5 12 0 R /TT7 16 0 R /TT3 10 0 R >> /XObject << /Im1 13 0 R >> >> endobj 13 0 obj << /Length 14 0 R /Type /XObject /Subtype /Image /Width 945 /Height 390 /Interpolate true /ColorSpace 17 0 R /Decode [ 1 0 1 0 1 0 1 0 ] /Intent /Perceptual /BitsPerComponent 8 /Filter /DCTDecode >> stream _ExifMM*bj(1r2i-'-'Adobe Photoshop CS5 Macintosh2014:02:14 12:23:55&(.)HH Adobe_CMAdobed            B" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TXW2:F&.Qh!Gwұ?>2uD2p.Ko `GA;ڏY߻),oX?}v:: s@ؗzz_3Is6ίC2j][\.OR_NuA%}k5e2t]/8LGKu0zQϫX+[Xd;eMX?й]W n_nU-)-eᙷ#}h9eH8qm5~c_Y?7BOZ.h`a,`ZX2l{7{=),_QU9n4bed6M}m:}/\'s:Xk-5g~絍s?Iumk_ؒRI% Z`\cQ!յ{ݽmf=?oQ%>~>ޥ{f-6 i;ji߹ߘޑӿWWOuӖceM.h?mIO$>Z2:[7|v4XZ\Ul16gP\[dh?I%,eLu81D̫,eLu81`#ӯu=:{q3?K֓ݓ=6nTs.#?Mַ)*m42kBL#Sm}sG;M5QSiCZV_u~zgF1ޯKe;7mޮyy>3ޥhg{}ym=*Όō~ Cjw]UkѰjģE8ղcEldS.~^7^s:ssZыl,-{;9S;'VYxde̺~m&7eڵ[ !EV[׏cog,2slCtc=۽sO ztg@~HFM`?rJzG}gU/7E{#L]GV^OӲ/z û+fKֶ>׽o^:wZv(R\uB~}/?C/F*۲k1ꩼ ?jJnmgD{֏] \vf%UӒ@ˡ%GYT}SVO5ecRu~INB;cu/ó\Hf>v^:g׿[:Mw4Z}_uJUl1ĦU6R tХöOQa;?,eLu81{:G^zu.;?g3~ӭ';'uRs.#F~?9g6-iM- Н)ƿ5=w@xoyc95V=HNw_WzOO_?CP66)x՟Su~;Ѿ͖W]b5Oy՜_|,|_H'd}?IOC֟| l:~Ye֐O ip%2ʖÞqpnx?ؒzgo]ƶTm{}ol%V~2,j_԰i:^˧!cgW7u?Rꢯ]!J^ow{޳8}HкEY^]=wz)u7tZ)漌+݇w5XaFVp:v9p/,߶,/_Y>t*Ւwm-s]Rn:4:߫oèIƭޙu_dԒX2֟k%<ǻng%YxXFNefc+rYpO dvG2럵>WikcLnG$GuK4@>ֵUOW>eU9]/q{u>DZ{Z/F.RS@½8}3"uTVǶAc[cIOUdt۳SA5.wV[?y8#r8|/?tU6Z[5$ K |}j?V}dN~̋Ub~nt}OMvĹ0%S}?ܒ`fSD9u2v,f\c` qR+'~sv:ֈ@!lrI50;BJx8>^ҋ;t{/C6Fo~X} ?܊.?Z:7Z10Z<z_Cu]s?ƯԺhsʳ%AUtVS1Y}dTr+m;WcC{U<n/MĢѨ}tV5)=}W[r文Ưիxnj̢'=߲:ENT -;l{ePPeUW>hc+?`},0j{I2. [Nmk_e9}_xUVGƾ8%< }Jꤘk37)לZvn^-piBq3)z':/NF o۝ekCm1ͭpQSTʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$Photoshop 3.08BIM"Z%Gpymelegal_logo8BIM%Щҩ76GtT `8BIM: printOutputClrSenumClrSRGBCInteenumInteClrmMpBlboolprintSixteenBitbool printerNameTEXT8BIM;printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@Y8BIM,,8BIM&?8BIM x8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIMQpymelegal_logonullboundsObjcRct1Top longLeftlongBtomlongRghtlongslicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlongRghtlongurlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM EB{) Adobe_CMAdobed            B" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TXW2:F&.Qh!Gwұ?>2uD2p.Ko `GA;ڏY߻),oX?}v:: s@ؗzz_3Is6ίC2j][\.OR_NuA%}k5e2t]/8LGKu0zQϫX+[Xd;eMX?й]W n_nU-)-eᙷ#}h9eH8qm5~c_Y?7BOZ.h`a,`ZX2l{7{=),_QU9n4bed6M}m:}/\'s:Xk-5g~絍s?Iumk_ؒRI% Z`\cQ!յ{ݽmf=?oQ%>~>ޥ{f-6 i;ji߹ߘޑӿWWOuӖceM.h?mIO$>Z2:[7|v4XZ\Ul16gP\[dh?I%,eLu81D̫,eLu81`#ӯu=:{q3?K֓ݓ=6nTs.#?Mַ)*m42kBL#Sm}sG;M5QSiCZV_u~zgF1ޯKe;7mޮyy>3ޥhg{}ym=*Όō~ Cjw]UkѰjģE8ղcEldS.~^7^s:ssZыl,-{;9S;'VYxde̺~m&7eڵ[ !EV[׏cog,2slCtc=۽sO ztg@~HFM`?rJzG}gU/7E{#L]GV^OӲ/z û+fKֶ>׽o^:wZv(R\uB~}/?C/F*۲k1ꩼ ?jJnmgD{֏] \vf%UӒ@ˡ%GYT}SVO5ecRu~INB;cu/ó\Hf>v^:g׿[:Mw4Z}_uJUl1ĦU6R tХöOQa;?,eLu81{:G^zu.;?g3~ӭ';'uRs.#F~?9g6-iM- Н)ƿ5=w@xoyc95V=HNw_WzOO_?CP66)x՟Su~;Ѿ͖W]b5Oy՜_|,|_H'd}?IOC֟| l:~Ye֐O ip%2ʖÞqpnx?ؒzgo]ƶTm{}ol%V~2,j_԰i:^˧!cgW7u?Rꢯ]!J^ow{޳8}HкEY^]=wz)u7tZ)漌+݇w5XaFVp:v9p/,߶,/_Y>t*Ւwm-s]Rn:4:߫oèIƭޙu_dԒX2֟k%<ǻng%YxXFNefc+rYpO dvG2럵>WikcLnG$GuK4@>ֵUOW>eU9]/q{u>DZ{Z/F.RS@½8}3"uTVǶAc[cIOUdt۳SA5.wV[?y8#r8|/?tU6Z[5$ K |}j?V}dN~̋Ub~nt}OMvĹ0%S}?ܒ`fSD9u2v,f\c` qR+'~sv:ֈ@!lrI50;BJx8>^ҋ;t{/C6Fo~X} ?܊.?Z:7Z10Z<z_Cu]s?ƯԺhsʳ%AUtVS1Y}dTr+m;WcC{U<n/MĢѨ}tV5)=}W[r文Ưիxnj̢'=߲:ENT -;l{ePPeUW>hc+?`},0j{I2. [Nmk_e9}_xUVGƾ8%< }Jꤘk37)לZvn^-piBq3)z':/NF o۝ekCm1ͭpQSTʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$8BIM!UAdobe PhotoshopAdobe Photoshop CS58BIM>http://ns.adobe.com/xap/1.0/ pymelegal_logo Cyan Black ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$&-2YJQ.Y}{o;M|߽uv/{,+7{^kK7LO]G3?;S;+sv&۝CCOIQo % 4ۆii22ߺ_C~׽ߺ^~{߽u~׽ߺ^~{߽u*oS|VMt[DZ;5f޽Tlt817k(Ji㫢PHDM[C9ubiϟY"c{ue?>E~o Mۻt00~a\:<=G8Zۜٛyp9tP>m\k@o{^r~׽ߺ^~|?M?w/~ᄈϚ-c0*$;F*1ӻ?'MJJZyi'׺v/{,+7{^_7YK#Wlo~2ҝżr|-f=;e>f'[/pmվ:=ǀ""%YPuV;S`l~yz}gsԄ\Z-÷riX3'K~߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~KK[y_ȮOIخ6=S[7lC IQFD[㰔̂2)u>d|׺;M|߽t7ei?G ;~w氙Ncy#b;Gd5%~>gheGXܫ~+߽u~׽ߺ^~|*c=kо{\6O[{h읓6 fcp{sm"5,1C {u>d|׺;M|߽uv/{,+7{^_7YK#Wlo~׿ؿoGȯ{ñ4g,_ߺ^biϟY"c{ue?>E~{>d|׺;M|߽uw?n?/G0^/q[ whI]K}e,S&#F߽u~׽ߺ^~{߽u~׽ߺ^^~׽ߺ^~{߽u~׽ߺ^a_\n{Ɵygݿk~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{0},>6/2Uu>QL~xhaaI >^hؠ<^n}[-{KGSSy#kx{:U?Ϳ'_w~߽u~׽ߺ^~{߽u~׽ߺ^~{߽tigۧjg3gs̥son=9]Lu̾/!c!I`DP20`{^ !R 硟c {l=kٮ%槿I [8ڡ\G6[׺ݫ߽u~׽ߺ^~1};;wa1{i[l}awPTbXL:%bک`UhFV=ߺ_?w6 -[񧷛+pe W&ҧwuVF<}Qfc塯tV5u?߽t{ig{kfrss3pÃ9-l,FgvSzytQ]H`{^>ٽˬLmjD{c鶿ha\AVՔ1 ׺~׽ߺ^~{߽u~׽ߺD;^{srԳm6,Ù*öO_m"9mן)VW6zy]}{ʏ=7m|xdwv嫈M:JSvzq_i)S$k-MQu~վ$m͍<#*v7]۽_CFB@iݑӈ K-9|j|}J{^쥱v>-z㯶'gMp[7e< $tMv2 (*Ln'GƼ$q׺U{u׺{^ |~k׺{^{$7d%?VGg|%݃fSQ!!=>_t^NIdpe m4Kjb~>{{u׺{^{{u׺{^{k5|O=U[cuv'k Nޏyj㻮2[iu$lO=3y ̶g5ej{{u׺{^k?{u߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~\>A{u^{{u׺{^{{u׺^~׽ߺ^~{߽u~׽ߺ^a_\n{Ɵygݿkeb^ݵ-SrUT&*(+mgHߖ6gܠQqD[NKPaOW>}3'v+X_0(] 3+xOC_=˿M:x9m?B^g{SV{rru8?3[O׽'yܡ{Nd)Au~fw?o h7(n?)7^? ]{߿ٝO[M׿x9m?B^g{SV{rru8?3[O׽'yܡ{Nd)Au~fw?o h7(n?)7^? ]{߿ٝO[M׿x9m?B^g{SV{rru8?3[O׽'yܡ{Nd)Au~fw?o h7(n?)7^? ]{߿ٝO[M׿x9m?B^g{SV{rru8?3[O׽'yܡ{Nd)Au~fw?o h7(n?)7^? ]{߿ٝO[M׿x9m?B^g{SV{rru8?3[O׽'yܡ{Nd)Au~fw?o h7(n?)7^? ]{߿ٝO[M׿x9m?B^g{SV{rru8?3[O׽'yܡ{Nd)Au~fw?o h7(n?)7^? ]{߿ٝO[M׿x9m?B^>MvEQIR8 ٍG'"SH3~Woo{UV*ĒI*N^v!T`%ؕ4kM%VDgi+ FX@ną9myf'64FAxAJ߽-WoBV0[&*T zт6 _߯{uw|>cz\~OT:G(VYۿnO<40$/4ClPS}I/h_w-ϊӊ\)<5~I=ϝrC{uۛO p>{7{^{fLŽO1==1Mf%,̹d2AtRUYG{7MnFw{&׷@;~'2h1_룢UdVWY7MJ T%nH>.~Q_&ع&4g6xwh/%v'ɍDb٘A}al^3a >BT{u׺{^{/+k7#߽u{^{{uY 5qeu/iN5rHpvFSw&r⒇ڔ8gJSb&dg_{^׺{^{{u׺{^{{u׺>vG;ٹ.;hEGkު m͙Q$ՕuG~{߽u~?ʛW'ߋ=ߺ_w~׽ߺ^~{߽uFu5e=ߺU׺Y)6]o|>Qfvq߆Uo ԙlx5$uGd~{Q˲Pu@m(_?}ߺ^6/r>{?z?9vOj~׿ ='{^]ڇ߽uoGGG.C׺54˯|]WڽKSۃiY⸌w\`kjmXhR#sT{ߺ[{u׺{^{{u׺{^^~׽ߺ^~{߽u~׽ߺ^a_\n{Ɵygݿke{Cue䩽:?ʋ-?ud?C׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{Ę($T1tn]A7Te?dege&{u~{߽u~׽ߺ^~h[ Oc?WSMm]s8E&cwӡi*KMRU**׺u׺DBHN,?htfthk귏G 3HUf!U@fE 1vuo~{߽u~׽ߺZ ?7^:ksɌibY?M ʵ،eg|ژIY]O)$m~|=ߺ^~o PT5/IN 6kh|; O9U`{DԸZMU%R)({^=׺{^{{u׺"°?#w!=ߺZu׺{^$3KO,S,O43BXB ~ڗ--"yz|e>Ni{{gzӥֆM ?{{3?+L6y#l,%X~&]Ɇn׺*{Z'E!9"I19gY@4,%6/2Uu>QL~xhaaI >^hؠ<^n}[-{KGSSy#kx{:^~{߽u~@?so ߽u~{߽uy@{^ߺ^~{߽u~׽ߺ^~|oGmcka)j(~ 3!g|#_#3X^׺~^wC|0 Q$6~M"fj_;m4(Ԕ*ou^{{u׺{^{ٛS~;do[kg7XNsWU8*׺!t>:lOcm]յU0cw^fdhifzͯ(jW!@/&o{^u׺>O|ꏈ?cxVto ٔ!$fһGrn].3H#Y {u*7j1}˷&h3=)6U Qκ¯݇OD1)gXj樭efuW{^׿G?_ڻgOaqЖwZ\~:8Ի3Lē~-ߺ^~{߽u~׽ߺ_$_Vo#6G{^\~"?Oߟ,'䖎,b ֕ۛK~tIOޘz824٪!F~Rͥm]ω`7.defsjlNNRz<:Hf5׽ߺ^L;|{=o.?K'ṀgOCS,߷~'~XqH!6()|[t; g^in.b?{$ι!׽ߺ^~{߽u~@?so ߽u~{߽uy@{^ߺ^~{߽u~׽ߺ^~|jD=Iy`jh1cAӜEWi5TS:9`2UAd_{^}ߺ[ZMFw?3dc{f*tS|uL> LGۻ9dł?u~{߽u~׽ߺ^~{߽uQί_l{wwl{^ug1Xҋ ,SKO V2%H:Չ(ߺ_=Yo]2?}͝ٻi$նru8l/E0d9Z9`6$~W߽u%'mw"/|`mvREҸ~,.GxCu{{uhOx7rKnĻ5C hi;6Yh^ҰIQ Aլ׺ ߽t6ޛoln]ٻ36%=_O1D!䪢YT@~}?۟ʛfyMon\Wa"*xKB zX1[U?h׺~׽ߺ^~{߽u~׽ߺ_$_Vo#6G{^\~׿{@_߽ta|_̫+;? ;m{%,1ō6xB+Wgj7DAt&Tu~~>Fo$?ZK{tofm>ҽLԔV%r/=׉Yy(Bk{uܛGLuG}uK^/]y Tm퀠8Y BII3.O߽uh~쩾5s߽uy~{߽u~׽ߺ_o[opc_S߽uX{?5?#?{^y׺{^{{u׺{^{{u׺{^{{u׺{^{{u^~׽ߺ^~{߽u~׽ߺ^a_\n{Ɵygݿke{Cue䩽:?ʋ-?ud?C׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u#HI#G)wwrAfvc`$2T=9 2KLUPY*RI$8{螉MxRDYX:`֢Mճ r1/pwivMR6i$b? ¿xu:ȶt==˷+ $ސp8ZשOu~׽}[Kcbs!?YS:{w߉o|ĒxMo_/?zE7BWu?q[?>&'Hu~׽ߺ^~{߽u~@?so ߽u~{߽uy@{^ߺ^~{߽u~׽ߺUT*/{[6nIT8T']ԙyʩ IqG0Gu4qwnӖnmӚn=ŜY,w7]>O/UHL5TK#r9'׺e~n%W|?R3iah귷ln<~b%v]E R0nʥ}{׿{^{{u׺{^{{uz'>?m/o OP{w`tBʧ߽u{^{'&_3ʹp;V#f3%Z>$sWUP5D(>)MuPbV r 3Kʿ 돎x1TTIN׸*Ii78YRX3'z׺r9 B-e29K#S5nC#k+*^ZʺZIev,ĒO{^{^{/HOuU4ڍ&ع,7F՘m+IQ Wد` ,MlbH}{7{^{{u׺{^{{uH}Gl~ָ>{ ܿu{^rS/q+m~{{u׺{^{u:]k|^N<fIяG';7ɶ6BF<**{'{^eMM۞{Ͽ{^{{u׺:{ſ{~oytĿqޏߺ_C~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u^~׽ߺ^~{߽u~׽ߺ^a_\n{Ɵygݿke{Cue䩽:?ʋ-?ud?C׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{Ę($M5>{U[)k頦\hQeK">/O#{O~{߽u~׽ߺ^~{߽u~?}ñ/xa|޻S77ʜ>w R4y,md>V R u4Η^oOOWy}TyLKo/꼝|br MZM4AbĔմŽ{~X`]g?޼5*;w6E=Wٽ9h04$T9*ŽiŸ{^u?Fi5LazkV{{z.j*ϘIF| h׺/~ՠ(_?G_p%&]݋E뾜WQ<4un)`xY2*}52G~}z:`tS|n>8v!1F:娨hi)4$ZI]fc~^{{u׺{^{{u׺"°?#w!=ߺZum7*rm>{QOs9oij: ZQ|#\{x!ߺZM{u ݽ]7Z]6] *H^m>1rB$,RI{u?~*쿄>O9FoH~ٷ6}UN2z2Pj+(U֭? _?;G߽uD~쩾5s߽uy~{߽u~׽ߺ_o[opc_S߽uX{N·ֽ-~Z|, [uWO|;ɐ}"%Q~o?)?_׺.{o?)?_׺.{o?)?_׺.{o?)?_׺.{Qc'-_lw'V'6ޙ\tde\|r*I| ߽u{^{{u׺{^{{u^~׽ߺ^~{߽u~׽ߺ^a_\n{Ɵygݿke{Cue䩽:?ʋ-?ud?C׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^6/2Uu>QL~xhaaI >^hؠ<^n}[-{KGSSy#kx{:^~{߽u~׽ߺ^~{߽u~@?so ߽u~{߽u~׽ߺ^~{߽u~׽ߺ^~]Uݝ}$m=p9˹Gb1T5s-={ ܿu{^w׺Ow~߲q)OhT†!=PW0&=3QY H_{^׺{^wÁ+~ſj߿=OCŮ/P֕dUw$tKdo{^ߺ^~{߽ttlO])=/={=w3yW)#/]CAAVRI2Gݜ~c']ww쉚M];+;KYOtjT{w<.K:4"GK*Q~{?Wqo? uml+!2] m2E91Wr4yiGjغQDߺ_O~֘_ _?;G߽uD~쩾5s߽uy~{߽u~׽ߺ_o[opc_S߽uX{{u׺{^{{u׺{^{{uo33y ߽u~{߽u~׽ߺ^~{߽u~׽^~׽ߺ^~{߽u~׽ߺ^a_\n{Ɵygݿke{Cue䩽:?ʋ-?ud?C׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺h+Q#$hTDEٍLʊRN0q,V3UAffc@I$ugz%6R JnIfbPGZ7V2Ҙ˔pmݥ6IHځ + گ/o"CoWPvn.ܬ*$zAj0?^?{5>5׽ߺ^L;|{=o.?K'ṀgOCS,߷~'~XqH!6()|[t; g^in.b?{$ι!׽ߺ^~{߽u~׽ߺ^~{߽u~@?so ߽u~{߽um]#ؽ Ź66^n $OO}=oqyjxjg]3%=ߺB{;FH~{v?h{u@;_у=ߺ^oG`{)Q)GHu_J!VvvF;DV3XH}+J {^+#V*Vku-,MVNUzhˀ;0!$2[׺3vF{W2ZhwWc;(9=;|ZqOOR@Hu{^{{u׺{^{{u׺{^{{uzOs._6ƌ/{s ET}T{{a >꩒\6DVNօ{{u(aQ{kyss1I{Ƿ1=KWZ?T1<IHp{^׺{^{{u׺{^{{u׺"°?#w!=ߺZum7*rm>{߿{^)^"_1K֛t g[=$i2(SԢJ:)Óz|_to>יZjzL}y?|u,9YKY {,`vud ~|=ߺ^~}??GAuĮ' =:S]UT]}jf "{{u׺{^k?{u߽ue˓O|i|Ll&'Hu~׽ߺ^~{߽u~׽ߺ^~{߽u~@?so ߽u~{߽uy@{^ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~UDƕ\]2y)#`#R:{u){{u?g-Ppnv 5;$I7~\{^{{u׺{^{{u׺{^ |~k׺opPu~{{ut_)0<p>򪤤 =5>ܙ: 45ث Nn/֌~{S{|w~﮲.Mٻ/"}ɲs+!WOYX`cxpU>ܟȭH:dwZ^)WQ^Gm䦎8Wɡ uU*@u~׽ߺ_0_}Yu7]e*jjŮĿXuUnGw S1ˉҫ3#虐{g~^'?3|h]'7&LMt%@-4cjmT\̂xdb14"I.%륌7߽u"~{߽u--?~|=ߺC*o_o~.~}}ߺ^~{߽u~?-xm~V{^{CO%}׺{u׺{^{{u׺{^{{u׺{^{{u׺{^{{^~׽ߺ^~{߽u~׽ߺ^a_\n{Ɵygݿke{Cue䩽:?ʋ-?ud?C׺{^{{u׺{^{{u׺{^{{u׺{^{{Ę(${&{xۙl =Gfc򘼅$ʳRcXI{~7O+.n :j{!4CNolRl~{W|Od`K@}AnKdĦn*rTq{{^{$c(*N,'ͽM媆5tN#6/2Uu>QL~xhaaI >^hؠ<^n}[-{KGSSy#kx{:^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~@?so ߽u~{߽uy@{^ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~VG1T')׺{u׺< so{߽uo{{u׺{^{{u׺{^{/+k7#߽u{^kFqw/C׺u׺{^ >3{K ΣwߒIWScbIrUsT.%u~ZV?dCd2bMYԂ*X6G+hyUnX.}{ 3EQS,s5׽ߺ^L;|{=o.?K'ṀgOCS,߷~'~XqH!6()|[t; g^in.b?{$ι!׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~@?so ߽u~{߽uy@{^ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~VG1T')׺{u׺< so{߽uo{{u׺{^{{u׺{^{/+k7#߽u{^kFqw/C׺u׺{^^SwgvqN\}'eXM#F®X}m-mtTVqeuD{{usl]&E_]Wz)j1MO7S4,dsj52ۊj<}{wxw ܽlbwan޹B8.nS@?n:JxR4@u~sgv[Un'WRXQɻ;:O3 MW#>YeA~o׺{^{0m@ov{^׺'S|jv{^׺{^{{u(ηƿo{l{^=ߺ[?j1/G~߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{^~׽ߺ^~{߽u~׽ߺ^a_\n{Ɵygݿke{Cue䩽:?ʋ-?ud?C׺{^{{u׺{^{{u׺{^{{u#HI#G)wwrAfvc`$2T=9 2KLUPY*RI$8{螉MxRDYX:`֢Mճ r1/pwivMR6i$b? ¿xu:ȶt==˷+ $ސp8ZשOu~׽}[Kcbs!?YS:{w߉o|ĒxMo_/?zE7BWu?q[?>&'Hu~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~@?so ߽u~{߽uy@{^ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~VG1T')׺{u׺< so{߽uo{{u׺{^{{u׺{^{/+k7#߽u{^kFqw/C׺u׺{^ E==e|C7axetZ8aJ&+._})(:r@+_~~׽ߺ^~i hOc}ߺ_4O~?ʛW'ߋ=ߺ_w~׽ߺ^~{߽uFu5e=ߺU׺3S?ou{{u׺{^{{u׺{^{{u׺{^{{u׺{^^~׽ߺ^~{߽u~׽ߺ^a_\n{Ɵygݿke{Cue䩽:?ʋ-?ud?C׺{^{{u׺{^{{u׺{^{{Ę($'g-cpGVzHdj=/'Vei=Ƣ:m_<~#߽u~׽ߺ[w>~;_ZεaRk[O*)ksBhf3yi '*`0u>{{u׺{^L/[G/[׺{uT?]׺u׺{^{71[)׺~ѕ'g ג }RhgUoLͨxkf5|8-qN~׺5_5G맿{^5G맿{^5G맿{^5G맿{^5G맿{^5G맿{^5G맿{^5G맿{^; |qzsj|zz~ܛOpw-wvk梭ukS㩦AfP}ߺ_P~׽ߺ^~{߽u~׽ߺ^~{^~׽ߺ^~{߽u~׽ߺ^a_\n{Ɵygݿke{Cue䩽:?ʋ-?ud?C׺{^{{u׺{^{{u׺{^6/2Uu>QL~xhaaI >^hؠ<^n}[-{KGSSy#kx{:^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~@?so ߽u~{߽uy@{^ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~VG1T')׺{u׺"v+wȮo=~tmnu/s pAWj"@J{^p&xb};J);lGA au,ԪeV쑍DϿ{^F~{߽u~׽ߺ^~{߽u~׽ߺ_$_Vo#6G{^\~׿{@_߽u;~{߽u~׽ߺA/}t#}\]/^ζ84Z%uE0GI(9RΊGu]~|A){2%]ѽz5UOG ͋GAXPbZ6'~~~{߽uZ@Ἷ?BVǿ~wOIy8{/(yhKH͕Is E|L_!׺~׽ߺ^~{߽u--?~|=ߺC*o_o~.~}}ߺ^~{߽u~?-xm~V{^{{u׺{^{{u׺{^{ |~}~ߺ^~{߽u~׽ߺ^~{߽u^~׽ߺ^~{߽u~׽ߺ^a_\n{Ɵygݿke{Cue䩽:?ʋ-?ud?C׺{^{{u׺{^{{u׺h+Q#$hTDEٍLʊRN0q,V3UAffc@I$ugz%6R JnIfbPGZ7V2Ҙ˔pmݥ6IHځ + گ/o"CoWPvn.ܬ*$zAj0?^?{5>5׽ߺ^L;Ldlz]~a?l^*t?羫qUԒ{:Zj7|"ߺJ ;h{zm ]"CGU.W-IAQ%3xR!.ǿ{^׺{^{{u׺{^{{u׺{^{{u׺{^?׺{u׺ٷ*,ӟg6}6ڙםY U-]]du!~Em\%^@Z6:= Z0nOtd?5o>ϑ_^{j7|"ߺ^տo?+>EU{uA4?V|~{ViU׺Y+߽u [σWuW{^MEgȯ~޿cz_enyzA[w|m^:fnY}w䆪|*Ũ3u7{^{{u׺{^{{uRWTPSWYYW4tԴѴ552C<ww!UA$=ߺZO,9͕۫)/1UQMz~)M"N^7mhOO~iTO[vB`Ku.y6Roz!Fdнf ED?{ߺZ{u׺{^{Sԟ:~kt%D='T5;FRڴ,O4^3)1Ժ$- IyuߺWkz O3Sm? mY_P0}^w&RcUeBu6ǰv7f#U_~C:}j/oK~_s̥sonhjr5Jn~ӷ{^{{u׺zkt\tu?gu;9;Kک˦;LcvmDqq'ĒQ=znuB_ߺKNg|N]Iο)kolmB~8܆Ph+7YPhj(%>t6>{}ߺ^~{߽u~?-xm~V{^cO/gQ.^=W۳T=*2+h21fgrFakB`,MGXiu'/ttj~׿ /?W{u@K1ڻ߽u_/w{+_GL~{ y]::cw{^_ߺ^%W|Ύ]׺9t|/=_~];bO)zfO텅<51I׺ٻ߽u~׽ߺ^~{߽u~׽ߺ^^~׽ߺ^~{߽u~׽ߺ^a_\n{Ɵygݿke{Cue䩽:?ʋ-?ud?C׺{^{{u׺{^{{u#HI#G)wwrAfvc`$2T=9 2KLUPY*RI$8{螉MxRDYX:`֢Mճ r1/pwivMR6i$b? ¿xu:ȶt==˷+ $ސp8ZשOu~׽}[Kcbs!?YS:{w߉o|ĒxMo_/?zE7BWu?q[?>&'Hu--?~|=ߺBSOH7z̨($+ Gs~m S5GJw_ce/e,VW_u>" g1ٷh ݹ,t{u׺{^{{u7Q{rN4\G^hk7Zhw&OZ쓐/YT4-UTE}{7_ u_d7ejr.\S\>X⤢Xziu'{^{]]1 _!%>UEQvͥdQVUK:{ߺ[{b_|z<~Cvɍ mOFuQ*$0uvdqe7\A$iu/>_ɏirQĮ݄wnT",le}ٽ*`4v*`A${^QRQ_#OZߺE{3Kh䊳fcL&*\VGol UW3"ճƳT'׺ߕe3_ ~[ά3TcvȬ#6Bhq: 7ɨ TCW{^N/ЮzEaUǿ:[pT QL6/2Uu>QL~xhaaI >^hؠ<^n}[-{KGSSy#kx{:^~{߽u--?~|=ߺBSOH7z-U2b7m(wVutl,ȏYU0I>SwGÏ;:ju;K6:pv!]-ElT׺${DZ6Rtٻ1glmn]ŖY$ZLn2)&$H@7VH{ߺ_M t菅.in;!:*J,^*]UK\{ߺ[pu׺{^{{u׺ccmM;o`fܸAۃ zL#7Scr,$RYH${u#x? Mw|V;nle>Grv7x%WGME~S7ޮi_"Xsgj.ˉ6Zl\'A ֭-ľ~v7ma@o*hNR[j6'/(!U%={w{^{{u׺{^{{u׺{^{iv^~>|>ޫ6m ܛ+? 1٥ rts׺x|[q~eg7|8ɦz #bl&YJE1.蓓~/~լdU=knaXdl>]sj^4kepY5x=@:(S{uSTQAWI<ԵTEQMSO+QOQ2 ȡV~,|cˇȬNm.(; k!L(1GI)aHtᎽ@{ߺV׺{^{{u׺{^{{u׺{^k?{u߽u!fz>~}=ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽^~׽ߺ^~{߽u~׽ߺ^a_\n{Ɵygݿke{Cue䩽:?ʋ-?ud?C׺{^{{u׺h+Q#$hTDEٍLʊRN0q,V3UAffc@I$ugz%6R JnIfbPGZ7V2Ҙ˔pmݥ6IHځ + گ/o"CoWPvn.ܬ*$zAj0?^?{5>5׽ߺ^L;|{=o.?K'ṀgOCS,߷~'~XqH!6()|[t; g^in.b?{$ι!׽ߺ^~{߽u--?~|=ߺBSOH7zbY׭ $5tk133Tr$TMba Vߺ[Lu׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{Ba_=[-ff~ӱ~fn)\T+q5hWCuLlgЕ S*ȇ׺~{uPh:G!UOCAACO-]mum\OKGGKNOSUS<ƊI~}ٟ?L|!߻WtZ?y馤ݽX̗sa0>}>ަؙ0dU׺0OwM[Ld O6yqu0'w_q0uku׿{^tFϡ,{OnO}U\ѭ-{u*'W,ofmA~߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~?-xm~V{^{CO%}׺{u׺{^{{u׺{^{{u׺{^{{u׺{^{{^~׽ߺ^~{߽u~׽ߺ^a_\n{Ɵygݿke{Cue䩽:?ʋ-?ud?C׺{^{{u#HI#G)wwrAfvc`$2T=9 2KLUPY*RI$8{螉MxRDYX:`֢Mճ r1/pwivMR6i$b? ¿xu:ȶt==˷+ $ސp8ZשOu~׽}[Kcbs!?YS:{w߉o|ĒxMo_/?zE7BWu?q[?>&'Hu~׽ߺ^~{߽u--?~|=ߺBSOH7z|Jw^wbdBwwmM$KfSQb%DkvQr={ev&ߝؙ˿3ynm i Yݛ3[7ZMd%Ak{^׺ڇ15~tV,ynM߲c2Tb|FLFEnGP v?i̓ܵIc਍!{{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^K>|Æ3]1kNw1uWq13{֯1!:Chb0OuL>{?1_NîG>(B%) >ؙG/ոפ0bƒu{/-Kòø!eg 屐7M|Si*XT`㱔(׺Ї߽t-t/uߍչFv'Mv읝:™ퟚO5̨($6/2Uu>QL~xhaaI >^hؠ<^n}[-{KGSSy#kx{:^~{߽u~׽ߺ^~{߽u--?~|=ߺBSOH7z@߽u 6iDNs{^_ɷ{O"st~{M|맿{^m]=ߺ^o ?D?׺'9O~ս.esuϊy]7g܄{6s4T5/UG/=N|׺?~׽ߺ^~|n]Uˤz>JzFCK WqkiVTC aee*R֓~{;޻;:K{;au>Dh;)^Ux|YJ{uooamMC3o./o`PaH~G{^߽u~׽ߺ^~{߽uzᥥZR zzxy敖8a5,*${ug[s^{m{uz~__e?׺Y}뗿{^g[s^{m{uTUO U-T1TSTʓS΋,34L Ѱee%YH ߽u߽u~׽ߺ^~{߽u~׽ߺ_,Wgϡ{c.g=YkRdmlWla0cIW>{^S~^?/~&meE/rvfrsUUvfH5׽ߺ^L;|{=o.?K'ṀgOCS,߷~'~XqH!6()|[t; g^in.b?{$ι!׽ߺ^~{߽u~׽ߺ^~{߽u--?~|=ߺBSOH7zK޾{7{^{{u׺{^{=|~~׽ߺ^~{߽u~׽ߺD|~o.뜦_mas.bZm;JFFYR9m %gylB~ }om{x>n]pms5FK?^^;sy %W<~{{^~Eo|cO3tl~B<&]@Qt-RVB?e)IQ{{^{{uP|1}lm5KhK _Y~ԑˍm͟Q5WSR{ߺ_%~׽ߺ_Y/Jϓeݹ2=)Ck*d:%^}o)FmBZg*{^fo~׽ߺ^~{߽u~׽ߺ^~{߽uFu5e=ߺU׺3S?ou{{u׺{^{{u׺{^{{u׺{^{{u׺{^^~׽ߺ^~{߽u~׽ߺ^a_\n{Ɵygݿke{Cue䩽:?ʋ-?ud?C#HI#G)wwrAfvc`$2T=9 2KLUPY*RI$8{螉MxRDYX:`֢Mճ r1/pwivMR6i$b? ¿xu:ȶt==˷+ $ސp8ZשOu~׽}[Kcbs!?YS:{w߉o|ĒxMo_/?zE7BWu?q[?>&'Hu~׽ߺ^~{߽u~׽ߺ^~{߽u--?~|=ߺBSOH7z_4?a^{{|{u {Os׺7ϯM=W{^>_4?a^{{|{u {Os׺%:zOz;}I?3v]PƚYaƍ7MZ~m׺{^{,.'0d*(ח~g|3/߂~&aRoA{SrQ;OpPQ&+ )eϿ*j۝}Y j3===YGW6\䠨h߽u_^{0>WB]31:or?&CΧ!թtۿ?O ,8$|_~-orih O1D|MoOs\{{u׺{^{{u׺{^{0m@ov{^׺:fZ@ٿ}ߺ_{~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺU?Ϳ'_w~߽u~ۛ Gs{~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ_6[Ub>c|2קZϹRUӝݵghd iUbFE2'u߿{^Ftmon`Y}Y#;k.Sdnlf΅] {Fޛ{F=\=vޛc$mшak+:E ">{W{^{{u׺{^7-Q-6shnͿW|~wl\eV=H9' BlG߽uTɷ߽u`zg׺0?m{tz3~~Qo(J-?sNۛӤq=Z|6pf饪U±5%Гuk{{u?*Ɵ+߽toߺ^~{߽u~׽ߺHM=u;_3tk`{nV~pnI+ ~]/_eg7F/W,SKT 6Rxn)$2v,}{׺Ku{u`u7œ]$ˍ:Eت&Ru%N'Ll6ʣߺ_X~׽ߺ^~{߽u~ևg;:1-5`ѹjn VL.wc+ϝuy~{uTT55UURM%5U%U45=M5D,AQe` ~ڗ0c˗=weIӮ;}Q_\SӪ,tQ!qR@ BߺV׺{^{{u׺{^{71[)׺~OK߽u<~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^^~׽ߺ^~{߽u~׽ߺ^a_\n{Ɵygݿke< HI&v#""I30ʛ(RI73?n9+{x}uUPY$@ ׽螉MxRDYX:`֢Mճ rn.ɲJF $`G_W//o"CoWPvn.ܬ*$zAj0?^?{5>5׽ߺ^L;|{=o.?K'ṀgOCS,߷~'~XqH!6()|[t; g^in.b?{$ι!׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~i hOc}ߺ_4O~Ё5:ޏ׺{u׺{^{{u׺{^{{u׺{^{{u׺nma?2u0{{u?b?{~[{^{{u׺{^{{u׺{^{{u׺i񶣳V|5NOae, tcdydkSM" ,\ ׺{u׺\iS;2vgĪ➦p:+!2uķS1Xȥ,%f"TDu,~{߽u~׽ߺ^~{߽u~׽ߺ^~k %|ā~~|}ߺ^~}/T?6W{^u׺{^{{u|?/3%eܒw WCu^#?eiOM8\'_),ߺ_.~׽ߺV|Y/~l? ٛwoYO{511K{1zXaZ W'׺>'~#߽u FH׺#zIߤ?~{v{uA`;_޿w=ߺ@/QGNݏ'pua=Xyk`汛UGm*/%8ZJZyctu7{;~{߽u_#G_=#z'buE-T贸5UV{AC3vVSԽK,KbF'׺Vu׺{^{{u׺{^k?{u߽u!fz>~}=ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽^~׽ߺ^~{߽u~׽ߺ^a_\n{Ɵygݿkm ')](O=V)Ҏx35 !P-o,mmdBLjPk4'qQgz[-ߖjqk3 !EfU=EPDlA1Y(ant&{{&>r?&CΧ!թtۿ?O ,8$|_~-orih O1D|MoOs\{{u׺{^{{u׺{^{{u׺ d G|huh{ju$ 7߽u~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽uPe{~|aߺ^~}?{=׺~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽tW>mcۿ3"%Q.Tfnn,&s7b#Q7d4YHZEߺ_ }fUmֻs 뷫[ݻ77]w& Ub8預~{^׺؃W(?όf#7a3qUTp;=Qȫ2E.(v Kd'k׺#FꮎVVRC+pG{u{u׺{^{{u׺{^{pX䯑>;{/{^{=|~~׽ߺ^~{߽u~Ʒg9nۙ?յgW_M0AU i Hck~RϿ{^{{u׺{^{{u׺{^{{uzXd]-C6nghkFQW=S⩤HVGe>wȭH:dwZ^)WQ^Gm䦎8Wɡ uU*@u~׽ߺ^~{߽u~׽ߺ_o[opc_S߽uX{?5?#?{^y׺{^{{u׺{^{{u׺{^{{u׺{^{{u^~׽ߺ^~{߽u~׽ߺ^a_\n{Ɵygݿk~׽ߺ^L;|{=o.?K'ṀgOCS,߷~'~XqH!6()|[t; g^in.b?{$ι!׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~֘_ _?;G߽uD~M3S? l{ǿ{^{{u׺{^{{u׺{^{{u׺{^{/{^ ׺{^Ϳ#w~տu׺{^{{u׺{^{{u׺{^{{uf_WП)v-tʹmɍem_ DUQ)(!L@%Ncηu~{߽u>ͽܻb-oWxllm[ #M4n*gl}׺߽u~׽ߺ^~{߽u~׽ߺ^~k %|ā~~|}ߺ^~}/T?6W{^u׺{^{=|?`~YTHIO3œ}7^6HCIY3eJ'7{ߺ_~׽ߺ[|8=!Ѿ1vo]lםE{F87c}c +_b`o5{ߺW@T+/?iuU~{V_>ܫ׺S|ѧW߽uYOr{^OF__~׿ e??ʾ{?}ߺDA>#t/\N龹v~ݩwsӅߘWފ;=S#Jl43m~|}ߺ^~}?=}ox//)Q])KS,4W;+b:&"Zu~{߽u~׽ߺ^~{߽uFu5e=ߺU׺3S?ou{{u׺{^{{u׺{^{{u׺{^{{u׺{^^~׽ߺ^~{߽u~׽ߺ^a_\n{Ɵygݿk~׽}[Kcbs!?YS:{w߉o|ĒxMo_/?zE7BWu?q[?>&'Hu~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~֘_ _?;G߽uD~M3S? l{ǿ{^{{u׺{^{{u׺{^{{u׺{^{/{^ ׺{^Ϳ#w~տu׺{^{{u׺{^{{u׺{^{{u/}Co|S\ۛ^ S]F73ŒڛkWenJ:\ ȒB${~RGnõ&5y=%4mܜ_USjguQS1 E[IS ~2~Ldr[]Yb)8ܖ:j,;!E2TPS I8mE[}%$L5]7wFʤV1WӊlL#]ߺUi׺+)?'UG۝ 3_|ڽD(Jmdcj Y.ux3=g0 <5b2ꈪ~}=ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽^~׽ߺ^~{߽u~׽ߺ^a_\n{Ɵygݿkdþ{cRؼ\Vy9D:2Ξwxᡅ1$y?bO޾{ECnP|U-OVO(I|{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~֘_ _?;G߽uD~=mFX I5[5AQWA_ S9<2INi`I߽uGs?m~׿6_??huA|QG߽u >{m>~ ?s~{hx9{^Gϯ}ߺ^>}(@~׺Gs?m~S&C=֔;pmݠ2kq J0˚eDy%{{u{^{{u׺nma?2u0{{ue IS?~2n.dŻF|}-eebU[ XYi+X}(@~׺Gs?m~׿6_??huA|QG߽u >{m>~ ?s~{hx9{^Gϯ}ߺ[g~r7O}}c֙zI&d2vnZrFqʑx=Ou}{{u׺{^{ks˦?Ǒ3zG\C|J^_o [!#^X 3ߺ_"ϖA|=]۴dѵ^*S_hi\V9ءgQ$xجK{ߺE߽u~ՙo?]{g1[ j+s}#Igs-\o+gF;u g<&/ {>ؙ#?3Qg?[Sin Bbpn~^WV™jRMC sB`;O{{a]cOUlOTȱMJ=vPřAu?QTT~#,u{XgxjwZE:H⚶Ze(j? >u#߽uD+?k&KYUcfm*to {ߺZ^|לifPσgo2 0b6ɥy,V:%bY;3{^{u׺/o _l~ѿ~{߽u~:`/_!Z!CQE=sp KOq/&Dm2nȋR\߽u߻u~ޝ3U|v[yn,2׻sŚ$O+X]'߽t~m &>J1,ۈ~8Fć1P3RL!f{ߺ_S?~׽ߺ^~{߽u~׽ߺ^~{߽u~֒9to͛jq*ui}f* 7cdV[Mef ׺{u׺U|Un.Y=ԕ5qHtNeSɶ,O%$k{ߺ[/{u׺{^{{u(ηƿo{l{^=ߺW z':{:p X)vKm M0ҮHSm>~ ?s~{hx9{^Gϯ}ߺ^>}(@~׺Gs?m~׿6_??huA|QG߽u >{/O_|wm>8l}_oPr_=r?&CΧ!թۿnO<40$/4ClPO޾{ECnP|U-OVO(I|{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺZa?~(~߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ_gnm^1{u߽u~׽ߺ^~T60@}ߺ_o~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~}.@+o?uw{^s~׽ߺ^~{߽u~׽ߺU?Ӄ~Ml3Zh=ԹJ흹'Iq9#_p>js==,{ߺ_/ R|MQU./wUq8lRLObɑ6P@ez K()S ׺~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺWQ?Wd]ֽIUJϑOw6.FGcOC.H!l^ր{{u_OM[Xt?s`v/~1D*jcO_m^; 2\͢7E~_w{^{{u׺{^{{u׺{^|]|j?}˳;ˬww\<TTaqbj)1{ƹj| )"qʏ~so|w~^.M[}ɲs{,hdOYi)Qx$BU>W׺|%h=u7fiq9` ܫ׺S|ѧ+W߽uOWr{^OMFȯ_~׿ ??_ʾ{g|_??]!;+u6C5ٹ .K'Y%Fn-suxj8I5x>~{߽u~׽ߺDC_4չ}. 핵3!l~V%p6YLxzlu\d\{^@T4?iU~{i>ܫ׺S|ѧ+W߽uOWr{^OMFȯ_~׿ ??_ʾ{?7"}ߺ^*oπ4E*u@T4?iU~{i>ܫ׺S|ѧ+W߽u'{R|R_Go.޻{^I~ٛPQ媷]uF ;ᥞ !,~l ׺{^{{u׺{^{sCDRe|k{dY.b_D퍍D`:fkOs쾿c1JU2jϽtP? ??_ʾ{#қr|46fl[gvf&j)O-f砤jY xu" !QcPh#4P@a׺׺{^{{u׺{^{{u׺{^H wun/?;O^b;[d;B~Oj7>ڃzó1v3KRhjq),={v*oπ4E*uR-?U5uoUURvjJijzj~,$TA2GBX#߽u?CtKd@aib;=Sb.(7Nyͯ2V غFB@~ {{u׺{^?%go&~av{wcvnLv`7~h Rf U:ZU +QuS|ѧ+W߽uOWr{^OMFȯ_~׿ ??_ʾ{?7"}ߺ^*oπ4E*u@T4?iU~{i>ܫ׺S|ѧ+W߽uOWr{^?%d>b_n@e˂]:z :dڒjR裎WO$I~oy׺{^{{u׺{^{{^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~_r썗X7Xw.ikT%e2ǔAOVm2f߽tcs߽t#m^=)duŠ8 ))b1bgw,V${^u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^ endstream endobj 14 0 obj 760549 endobj 18 0 obj << /Length 19 0 R /N 3 /Alternate /DeviceRGB /Filter /FlateDecode >> stream xwTSϽ7" %z ;HQIP&vDF)VdTG"cE b PQDE݌k 5ޚYg}׺PtX4X\XffGD=HƳ.d,P&s"7C$ E6<~&S2)212 "įl+ɘ&Y4Pޚ%ᣌ\%g|eTI(L0_&l2E9r9hxgIbטifSb1+MxL 0oE%YmhYh~S=zU&ϞAYl/$ZUm@O ޜl^ ' lsk.+7oʿ9V;?#I3eE妧KD d9i,UQ h A1vjpԁzN6p\W p G@ K0ށiABZyCAP8C@&*CP=#t] 4}a ٰ;GDxJ>,_“@FXDBX$!k"EHqaYbVabJ0՘cVL6f3bձX'?v 6-V``[a;p~\2n5׌ &x*sb|! ߏƿ' Zk! $l$T4QOt"y\b)AI&NI$R$)TIj"]&=&!:dGrY@^O$ _%?P(&OJEBN9J@y@yCR nXZOD}J}/G3ɭk{%Oחw_.'_!JQ@SVF=IEbbbb5Q%O@%!BӥyҸM:e0G7ӓ e%e[(R0`3R46i^)*n*|"fLUo՝mO0j&jajj.ϧwϝ_4갺zj=U45nɚ4ǴhZ ZZ^0Tf%9->ݫ=cXgN].[7A\SwBOK/X/_Q>QG[ `Aaac#*Z;8cq>[&IIMST`ϴ kh&45ǢYYF֠9<|y+ =X_,,S-,Y)YXmĚk]c}džjcΦ浭-v};]N"&1=xtv(}'{'IߝY) Σ -rqr.d._xpUەZM׍vm=+KGǔ ^WWbj>:>>>v}/avO8 FV> 2 u/_$\BCv< 5 ]s.,4&yUx~xw-bEDCĻHGKwFGEGME{EEKX,YFZ ={$vrK .3\rϮ_Yq*©L_wד+]eD]cIIIOAu_䩔)3ѩiB%a+]3='/40CiU@ёL(sYfLH$%Y jgGeQn~5f5wugv5k֮\۹Nw]m mHFˍenQQ`hBBQ-[lllfjۗ"^bO%ܒY}WwvwXbY^Ю]WVa[q`id2JjGէ{׿m>PkAma꺿g_DHGGu;776ƱqoC{P38!9 ҝˁ^r۽Ug9];}}_~imp㭎}]/}.{^=}^?z8hc' O*?f`ϳgC/Oϩ+FFGGόzˌㅿ)ѫ~wgbk?Jި9mdwi獵ޫ?cǑOO?w| x&mf endstream endobj 19 0 obj 2612 endobj 7 0 obj [ /ICCBased 18 0 R ] endobj 20 0 obj << /Length 21 0 R /N 4 /Alternate /DeviceCMYK /Filter /FlateDecode >> stream xuTAi)AQJUBC VINww]-vc`u]Z{>3{3=3k֨Z#<4b*5aRvfѾfJJmyV;g/3r}z9dz]%sՉl|"<'r ԖC5ʊܜ3* siW?gc=Գg_DŽEW;^_%yyw?W$VڝWLA ©zWueG45\mtt5tXq[!C*jQ#ƙ&{Mcvu0Xnb}h!6tצMv+;prMSn"OWwN_??]-m h bcC`;aeeQрh,&6^Кؽ{0i"yvϕ=T݃&i]3|2fENޗw4v{zS$*(K[ʺ:1[1_yY@]  5(Z􉮤Dr%ELݦeػ9%\ ?+x.Z.l-r`|+ղM͇[َ]˺{zɶѡKÏFtMxL*F8;=sgy9 .^rB7o~}wkqcΧ%Ϻ_G_~Se7,qQU]SYoW Wy6]IFiYZO-F-*r^ifnC-}c=v~:9m9]G<=mVx}~3;ي( =0c]eQ^FğQ_b.yiLdh={?02:~p2L+w=Z<3G'4.ߣ 0y*płɲ['+l*V%WJDj "peW.M$RJuNrih8X#%v(4ShUWÃ-3KF]=z}M3/\F_2 :6-<}̗ses^^23JU޵Wo,ҹmsn̽=<,Q<94s^\yM[w,~iiҽ__}v"w߫~lݲ54hij]dWܸ)C֪F4&dz-7fްhoikyzUuͻ S;:l3OWwO?G-:[~l}AA#=ۛC;(=QQў1Vq&;W7{§w_&=M^s}8p=jՃ7?x/,3ʷ(XzcRsKKerW*U1@_DA顝0أ82plM Ҩ^]rfN+qTR;#?d7hiIoŴuW{=} ' G>YMTRN^V;z&,ju_s._̽,rotx{Ի1%5 -]bW_ß~=ҿ_t4izk~FDԝз`cKFk,LV6W=jcrzyuVl6lUؔf`dʁYoCk[wk^D<|]oڂښmKQ ipZ;q "4EňcAqwZOÄĆݔ={=Y+S{T r&PeֱYrs# m58qG%K/M[!:N(+D*|5P< gA2i4D0]p I$ .Y} #,,3}_&(Its¡.>P0YŦu{[z;C9uW{ú#[FIoZ=k4}٤/^ty<Եw|pN^?s^}ѧ_ʿk9^aWw–֏g]iaڰca0sg2 :W<r6r+̩RMP34ӆ 2ho݄do2oQ/X )B dBxo b$.$4'~ +-qnFy2CK(ٍۤ绢 +v mm=. Z ڠ8}~hK~FPH& r"hS_`9蠟q>Jүdp2$uN>h*[g^1z]H^m!%2[f@n2nP4Z%$T6`dߞ={v J@*x_~"!f@t\hs'4^;rhT?k߱3O6ut? Qm_@lㆊ=2Ai@{_mkԇ/]*\)=-\<% 1l!.j~/hz5f֩bKo\1Pm]`*n0qmJ4:wc0Ut܀}td69iuǽ@=:`i-@|/o Kv;pǓe:_y h] ,Z0C'~ƆG`vx=OP {jOC?_9=YB&)hyG{"2aw簝wP_1cgQ]$4!YACPz!bp:>7; oFZӃny~rG-A^6'Bpg3:<,z*X yir/b]֞pf: stgl:ܛkG=f`/Sкk@|Y\ ᛹u-FMNAi`w& 'F5u-ղ>!ي * YSQnjˠ*J3+ DD]`_bC[{Yړ%s{GP84)6 Ȝ'Љv摣w}&ð]#!eTyZ.?h M,Z VxTAq=nD9gNf d.0Sca >f v;%e@e;qtu k dV3ExO_7.T[sbٽ"AfpT-=`L'*I{ۃhSҙ%x_^zQO1'|#P} H"zzD#[ ݨ8TcMxvNe,e&D$ ȳB}~H'bh v5g7>o  O0ʮ&.r {܋l\< j s"Ž{]x,s~zה.mY0B=KjDwJכ?GZ*UCTʄ;E7=5~]^߾dzj 6s37BGBPF\o1E(?pW]N&@U:ݧLqWREybt4J}]=E[!-.`*#% N p: `q7 xv1hy$ض ܹ_lQ;+94a5Wn>N2N!Q dU!$őyW D|>El‡#Bpog+nգXy]x#6FE/@;pՋH,(_L'3qݘ chff SZT<AahuÄr P& \(01)iN0پ kW nEb.\x$uI͔Ӽ;dS.."e\)'83r4_A $tz v>z*g0)^SbzgᎳnņ1oŬtjDo2%=o0l;(~mo\CQWpp a6D~z/8kL%^}H6p0ugysim@PO5X A>sq B=C>ħ'jpREV9q Y؊bLPCG2Q:‡8ˤ=׿: gc,wbH}QOaO}!)v[Ӫ,`m<0§I3Dk} u=dYoA"c<"8t,{*nǦJ馺hTб &0gw/R Z+@0*iTY$j1x[~r=\` rԡ7xNOG>#.*ֈGjrg%x]s( pN|%. h%Vt y-ѯǞNXL1bg8#Sgb(?v5誀5h3zCKcjC,)RDŽz9EI譤k%D^F#$]mB>hsdNL . v&,k$93%B qCm29gg$JNݶHeM2&V|re&R(IEy,\) *^QٿI 89њ*}YP %"|ݘm{$uޓZ@)%]3!kn2`k&BϨ`yohk+w{-q8KԂ$]dx7Ă4ǶQVd<~(B`ٖkfnkڼj9z9(wcMT2V'˩Ϛ%_SRɉ1/6[ q)B].fUEx7tU`yz9}"KV#H#āL:-+p&R;1ޖUqDV%C܈ucp?K:U3Fh/RXv;Smh,mJnEӧO4kxgq,.AWۇi.ވ:0B+!~[)z=$nbJLQI#]eqDJ u9ڐkEZ]b>Pg_GR%%֐4+ƥN~Di*pDvl f×:+7[adJ׻\{`o0HB·mX!5=O(0| B|ۇy7[ rkhGjxĮ#<^n.+Jla{ZO~lx zFw@R#W5mINJ5)u(9LW!1cU,HG7$irBײh}#M'h"5Dު8IzJ0%b̡6UB5|!K iDmQoXz$O٘,xZ +X|i÷ITAe燐NgPٴOyb mȚ@Stkse|t' Fe9w[W9z4â䆽J; ޶M+*zbG/ed]~PUۣm>fG(5N`~V'H1Ltc>疷*c5ɃcbErgѯ¾2;!U𪪸00AxsP'kr[Se{O0nt\B f+,`ͰTTm*~W4?~'[8N9mүV70ĞBncV|Tc?*he8:* EkBxC7.Q7:dPg9 }e{)%iլN]᪼L/){oB1^+Њ;fZ\b:(#4[&8ՉCxuA^N?#$Vב s;I.,!dqA"躑_q`35 .̇g7}<άʩ˽"`50`]l ۬J{ 1A(<ŗy 9>K `8EKx:xLy*J[6^9I3|, t ߉p,moku%q%J]\lԒFMZo55 Cߠc%a'qz i쯦`_=1G&葰Ic#'qo ISٕOm MMA 킸_`GpgyDátoGJ ݑ4޾޶DjxlA mX}6Z*Ie{O$oiy((I?Z+>fE243 u[<ZcCj QGɵr/{)Ha./dVw^FDCP^yIcwm_}ckNsȖfӨsXSztb%ZbU  87|k c(k:vǚE}M Y6{W˷X21[E%f2M#d:mﭚ ]ǖRu|l|[%Ww/P!a=b|8|F'YΘ=am q !G#fql| ~ | ~fc iAҗ3e";A@>ηT?T Ô"Vh 8<7F^Э5 LDg ^"Z@_‰B`i{fȌU}0fo2P j'Mv5‘5$ނ,@mC| jK`ƫWU8^ϫR9YiY-8Rk`jh$\l=l(sfD,t?RԪ^ T,S\FKG‡i\w(Pu Бߌ GzQZ;X>ƨb|n6mV6]F(iݓVjRP=5c+4绐W#>ԔM"V" P8@eKph2=΋ y\;ALp_ ey'9/67;xp.6JapbLGGރp r X:>i0<ƈ,fk4´!X wp, fإR̡h5HC$4*eBPtO$\?ԅh?}zbYƗ!O0 RB2>,"L3; dVL 2C)%*i'E! #G\)Hst $X\ 1g@toMc!lW> ćbF0^% c ՊO6)ށ!tO0CV)3G IΗ sXFib !> ^œ:-43G?8{!ega,k+؇l !CoASos=`K2h@]zԞ4*A+ 9I<%f.wtnS(P0b R6 ~D{+5BwD2wh AI&r\|+q>x0P9zH*M_-(uB@!zA.-r{*=>zS.B@v@4$fV#VH" vEނU Cn4nގs5c=aCL)e~~Q}ȷPS$i70JE˯VNe`W~tb3 /n\ujD3x5w4Y H9܃ h BQ*v̚zͱlU:, O#B3RwQq͝B3>Px5n6K^4*+m#QZK8%'#XRpOخ 4ޜEO5@Ӊшa1 l9Wg>J7LFqOn]`\͛wYF'!$K}ァݨs$33ǩ.gn)2wUJ}}`˅,\c]sͨS գDɕ{pE-ȇm+mvZ/Hst+oOz!)Ug9 #hHؙ^[`;w$zB/qy'>d^hfC} þsUH z%lR}8TS_yPCwp[A~cAo0#`!~BWS@Sp,",@+rhS aAa:X.Lj(F>3&@e 6\UB``8b"z`=~u*/ (h!J6,*oMuNInc-#|qU$. 3::PW0=#(t=+`oB f}a2_ ee.j!WL/Y>O2  c[Qjq؍S{}RCh+#帽"6,3 UB!Soȇ]Y{*}Qn7 +kta. 2P܍;ް۸ȿ /4Ū(8!sG>iAdkq#*}h(THSц(67$fCyvu)ew4i*z - m|ZcW_Q}"}c &'zyLgM$SjAǙ" WiQUAq/寷"^Ka~ĈQoRDž[׉3&ɝ8h sٱ*tKW VQdKV D^.CWM@AܨJTVUFb|ܢ8'Qk}P8;B=_g?-A(xǜ]1$<ɰAhHk5F m&&A[?7`+Mqpa#n'0;=/1Cޤc(9(JC'_A. '!1o l[Ld/802{e82SYLrp;dE ;GD nuL⟉o>Ŕ,T>ȱl2G̵eet%:bESRj$Q/'n{!lc##+zLC4Wj$(< (P\b vRɕw` {Fo&bdPgp}BU5sk0}lv&^^A.-H":`M`D&~$zFw uڇ{ߛri\1͔{u*3zٚ| D<(~A |al@|'l 8mF㷷isI鶪$Oܤkӥw#qD`d OveQ ]oY_?+0 ;ˌߟQD~$EAF>M||}^,vFF *PCdD FֵrjM>F=#U&t 5DdbiJO&-&&]s Ţdoq]aRUwڻgI^ @m_,2~z8 $!ǂzb143 kif Bg!a@vlhA>ޥXPQQ$G3v<[#G*o+HUl{b?-@5dO\`(v`HtDwG 5ܾ-]U,0xCt[I}Aa`u}wP#B^f"M>IeVMvR*dAKN'b\x{5F4o@7Tg֥UukjyubgDm!jyub#W0?Hd&קݐ𜰾Y Ye_]ң(ąΑ.b{WX(g~"Fe w0?so9F]Mj@8AmpgG)ԵůYtrO7Qʛ tla;ccwУvc(6w\zW a[3[< M-:lɞq|?1WǓ0&Xfc ԏ ˾TqhI•,Y4wq$~vȼ:JNГ fpݶ#Nʤp(iZ?:b{ӳeTk| z5 ݸymMduZiف${N 9WC91ڑA{ω0?FaҐ+pg0꭫{?~5ﲯ֫{ٖuS>#[ Qm[90bc:Ϋ3ϥXѠvyˋfɣU{jtڥ?Gv6΅׏1#k;ia! ]ĤR'++ *uT+XV>hЪIO[ 1] }Ck%0G{ i|jɳ `3x|)8p;\Un=_эSA;x7K*\; i&H ې+:nM`jh8C_r 1O\"/ Yc3׬nB#jg㩭p4N,SOc1ew!={LSiۄoe?CgVEEaDQ@D11HCEDR@n8]sbNwwp8Df.ygϬ޽)گ{]O28&vzzgV|ZfA^5!xW1I/D0W`NCWJ/ J%VUZv)JA늮CCިR*'$P*И AcEߘ;e\UZ#7!mM4*y5*dN8tFV,[#ƘtA?{*ڒꖧTf\HЦR/|O]cMWQ6ʹ${C4`՜،lx/ȸA=Ȩ((+q'eŴE9],j4K q\ϞGƌNqf>O[w&c1ي5IfVI#n]TBVO[vvܶf3񒈦zX.بX qS$XfkWO8R]RݓE_4NG{n6Qi҇~CX%>y^3W6bTW80;5be[WmȞy3 $GUq?l gYq kY5S:Y}p ͱ`opf0/|ذorHa\.)F.`ٙ2@ҁ{]:[{Ը&_wvJ}_QN(1`m0͘K"gfwE&BI쓢A4z$rM_# {X$3D+pک@ܛҥGpuYc8\~"3W!6k>^Po;&ZjoЌVkyxI_sɑ#V?!)m1iΝ=AFϦ$蚡zݣZxZXoaN2ޕ<H{8skyj}W0uO5>5n?d^wD5%k&q+3*,N1Ӣ"Ⱥ3~SсquѺNF2g0#DPE&gX񳒡7ޢu[][y1[Xe V>vSPnAᙙ3$wNb)Z7A5WQ+?y>]cYM;+N_Ud:$.Q\W!|E)yͭ2ejg؊,/δ`YǢų4/З$^aQ LoTܔ\+nR2챪LcU:E#c3čWN/?kFua s˞[)/ ~̛%b)a&!G{EmKHiv4.oJj֚iO(^dyޒ.Ǝ'I/_B@n_ۃ| }|*vc!,IފS-귘(~[NDx%bw`n{.S5W~]&$ 3Q3_)@TЫh <ؠTm'͗ai^:j`K"r@<G ɛ+SQ`ed:6m#Q ! N&Coag͖d?\=kEtN55-.&JGu,D}l5Gɋb 9,86΁=$tÿ-Է"֡__P1t4)jg Cw-=a,yϒ0 #YH$z r=iGsv\ hu;$(Ym"7K)@F '"xpȌ3R6䵚Žo|2A[C78X/-IkJN**z[~)/GW_]'iG!=~EPvl5̢iq1v26!Q]P|km'&CނZdp]Äv\(:$ C_<&϶Tx0ssEꪋk{ 5~t5Ϗ9 #P\`'̷35v/oXllŰ_ٝS B `W@1؇^TR>Wk}σaH6wX[8Ol^,sfܰO%m8/\+..90s= 7n Q~\lUbޑ%"{@l-;Y}B <-6 c3w8_~#;Mh,霢54 FE0E+,|ꯚN%Gͤ]hov+:A-OGC?/x`̓0g!n]2O\2_h@%iOwFTWՓA?q?i.'S&IĘ`"91;Xb>U/ [EPLÀ DmuaԢ0ꋈ.% ?YHBE;?'xln0H>mnHn!e,rԈP*AT@SŏWW3/\G{6P,GH?-zS,C货U!ZJaGQ3hGeSס5AsP)TI[C5C)G.J#Ȯf7Qu(k* ZvRpqƻqo|er, A{,ը:-Mې jX~ͅod;/v ×#$bw2d~4eTy ]NB`\&±3Y)H10}$®qX7-y&i8t`DE"!5OYJ(\`w \vؚ`ku6(/w5֞F  *%3dvfcS^S.xz oFMTAP/#qjTief_cx8t2`5Pwvd݁g; 跭}DuθGh^qm@uջUMyk`bWs fq͑]8z]0mI{% Xale{J]%o, <>qtָӇspiqqʋ'2غa)\0䫭c,#\Ϫ$T3Εӡq7)|43ꀸHIG>O"8 ч,'X :]?хchtLxj?wWY~9"1K g"mXNiLF_ y9AOF ~v`$a6e;ɕpit c's=hdЖ9NԵ: Jo{/= [ lNo MbL[vi0t$K2BBXDp\C"VPXs!d2aK G?Ƌiqbj,Gi͟ȡHGw%"hͩ&asJ" !;QOhrIHmJ"l\0SgXLY vMag%}˹ۀ gS+e͡Yo ;(|}e rW?QqbkQuCZ9h[nѼUkLy{S&{([۟U5mUqD"qv_e Z-KTu:VMTR4;K%ZRߞ7qV4-?ZUպ\鋥KJ0]{ !=?E|᝖K yFFbܧHbBƨl{}BMIķ~OZmR^t> ROk OQ~ ɭ^dˈ(XWx}? [BH0"}J(a\>_YXy`: qf:u<[*ҍH`=<_ܤ 6V N[R@oBx68sbK|PM!닞i ȅ`pj8hM%5fKHXΪXj«cUP>\NW>}MHӖl!R.[<["6ɬ`'E3VAd4za컩$r[B7yU@<2㖭^bvnX=i5ȌdɭfBυw_BNms;~p603fgC6&HMu'ZJ3(ItH *Qa{ ʧ͍Ʒ8a^uns:DCR}2_j ~ H|.czQgo7سuZVJ_ ,:bF *K&w?pPn6EgQ#X^:δ骉ֱ'rIӁ]'$䆈%:}Ƨǚ΋8!2_%nWFrϵjKXbA+lwcA7؂u)5w=&-%L R(3z#|P[.8mF#y՛1<)p J:Y wj櫲{SWr0?Q\M1e'#}\Ѷ䐲Mg>ABN}.#^\u\)<%2>8{L LOAjS#Bwg#f93+K1dSQcmiL$tX%f$9Xt ov(njflO4Mj5D*)?RFwr[ՒV;T"&VY+{G֕A 5y=!Yh]00{c0:,kn9^FK-*3@z!(pcvjnLI@^#z^KoUh|u 5wl@d 8uvs B oYq߷P-m&%r7}REoDJ{k34@m\]Z@ˊx𘕣1)`# d̦w ōhCuvxk_QڿRYHP&YBćySn?]ƅ!:SVZ_q]e'3Ƹb#.2|F̐^-KJsvI77 > i !-4jnѺ9sVIv/",n*g.$ V.=c}#|E8~_/D[DaE`ԎN6}!÷ [hM-jhD=A2X[&߻%M͗Y'?g98J|DwFLwi,,9ӝ.a[G}d0,zy]xpV&`ZuB^%RU1&d@fcICî⒴km-E;]tz3rta<> :K{C:\8:Q qKC*}3Pm}>94,\_}T5kp s*>KFcW҈{PbgDy]P;mf'͘N 7Kk~| ΀:o8-f`Oݾx #bn7<ߨӜ<z]4qne1o}Bx\rせfEiaC @upgĞt|\y ; {%/i"0#kAV; qd4\M?KC.1yR9ʩ8Q/w"ߞYHX~ɏ?vCp g ϵ]dV< GB&zvc1 ~eOCbT#B]osm{0;Oa>ϩH]Qy2,lu&V1z|.|xMFMꊕle;5Mו 8A%mNEd=-GT!t)>n>>ܪ߯p(DHDsLѨO q lxrx AUu61;t]a[5~.xw:4fߥ& SK󢓴&} $SdcԘ'úZfץl̬}jUr/Q$)aK]8&R3 'k. /!ad*Q ?ՇFǡ>z`!::ᎾFl<iEm6z ?a<!cbJg ^alFcQiq<G- IbERG_$xXkӈf7OWnA"Bo"aRoK7r+~ݪƘO{^Vf4Ԋk)܍?4.j,}L&G_Dԓ!E6e$ɵMUM5cIwugv62o$]!('s/8"|JO9Dw≺S]IQVɦk*BT4!)x0g29TRUmLiIm ]Y㪄 {%>fmyD&Ү&W#qfÜ3 b &8x'r5獒['@tj5nl/ u9z^cc}ʟ NiډMZw;5Y`e 0H !u>#,h_Q{S>wƯ@ b|oץ`*303 JI D2|2#ULY QQqѨ?>k@ڏ:Zgv^cR&% Ad!YV9=XT4b[ -xfB/'#2A8j9;; RS8+`C -lgclk upvk3D!<Ee-g#aS}mp Y}]c6QoNoBĪkЈsLaDͺӼ5G}-dA_VaW7'Տm_a.pf3+T.0%BB͛nhaggؙ C@ rK93*r0|4v Fd WÑVX=bUUy.i~aOM1w\,TGxvQ; ܀ <Ԟ#' V3x|/.&6PX8gR΁tG+p䠌Ȯl0OÒ^8O=VN8 ql?Frhc9T1l${ ϼVnbbitft^W`')ϭbGs#6bu[*1uvF&bZJ?b&x`>pl:z|`fc#c;;D?o~3WY ffI)fd_ XhS{3ԁa1h[- MD;%%+}i\;U3 rBcLxmVC3P?{MHNڤF=HE9 A`ݯKhxtbO 4) MNf,aPCf^ }6%2uSFm\P}{:Fg:[d^&ͳ@}exE1w6V&?QهT@ vE1ۊSQڨ7!\MꯨMVCK5*T^`B(n)5%dHi`}У7qi+XXXemRz@R=x_*ntU9կs/1!wЧa4'xjXM]/$o< +g(:kw21ptqDnaFބ4/)uDsL`aE\hs^@sDŽfJ}} f($'/ я4? N-š)ߐ22@f:4T!ՐnRI4 "^p l$^cGN n g=20?2wo3aߔy/)h{zOd'ʱ `%e 9qNqsFp=ߊ>O,hG`Ǿ#0ǁbƘ?5I$WzIcHfUto)AYU&-QԢ7;a]^Q9p1gHep'RXsR-g ' H?zC:%sF19PZ[$H׃Ԧ1@SCWY_PLM]ܧ2t73,{iȃ1 Gw2!~W h3CUi_2C>7Qu#lA M:~97Q:%}[AFî\mw\2_/lvvEEr5Ѫ &vz>0& eXdDg͠°: Dd#,^__WϐKwY(mLGc%v;0]ʩ. O| g Ob"`=AW氱Yi b{ mkuwkvnQZ )R,Gp4 -n%*0NewfQKDVgX@!S'!ޘL")9<'z$e}Y|g©%; ʩFWJSC/ejVA Pn~?e,kvpjMY)k/Y;eδ7-5^`5œ=LB.Vc)y7dq;[>|g0Jv}Gn~;'pOe,PY;dʵ%f\= `S1d[X'i-G2l9->; =oADQH <Ϯ S)`qusSs5ɖt2u07N.Eۖ\y %A+^lweo\qx G2,M*^F驯Ob\I=sq DJ s}Kpףe&9 XsP;گEfjmgJu1\ZB:g"⋺RzQcT\0VL>W,K&|[_v :Ț3lˆº{5 *O$Z*7@sa%č3ȓ>\nj|LEL}\nAW.җ_D%I@a"y.ث>J\ls܏E,pl&-VD'U]YR"sDp7~KxaM#n'X?ZT4eQI,A9zX+FKJEMToBq)ޥ5$&^e" RHe<*I,kqXNzi5i='kQ\*#syf|zŚH=E -r9xSJ{)iM >g[ ð圔-klYEtbjV,yQjZP8M]+\,CM$e{\8DlgAf}wVʟ3KYw ~iI1AvsaWVY9Rykh9kXZXB.^TL5BH`+&R5WD=7 9}S n Z|fe62T.>GE}%2{Q}VI.,#XѲ,4oF8w Z\[ٖƕ/ |Ν=dJ.cKCq2gm+5)Wb><T1SĀ[tLs<mhn^uP@˾-ϟl#I8m /,Ҫgw,,,f]J3;DDnR"d5| > ! 9 m% y\(h;ra#eȩU}/y|i*IG$Yw"_V#=K LŴHNY~&cпN]^2,a>ՒL+V"'jEAB;զ^]sK`nP`%T);#yHLf&w yy9#3SM19ezcUƽ4-1Jk@/zB0!yhsaW3N) Uwi-М׌ڽ$Mn] uI!Oe u/ bwuDP$/u=!k*3|*2{,V~s22q ,67k7\\ؚ|j3r7t´{u[T{TZQPTPBFgt bw؝zy뷯kuj4}Gzj{̖Rpޡ8I XnaA>,Dg8\_|C0?Ժgb"u/' K޴~* [qc UCQݾ}箍]/bJE>i*cGH.]MoZ -0.z4uUBʨޕTs3 P^f19#Nf;.yk#6  5qKF11N1\njCah@hQZ]S %Ёlm(} hþ۫=e]=dwxƅ- F{]i;%;/&m7MHx&s}'wfSxATnO [rQ{֏-뗍M=Y9|{:\ C |S+'US,_ vs4ź펪͊F7ɑ#d={_q?tVrtӣ;]m*դ(T %8+FGŨ۬Y .+\5[Z؅=xӾ0tĦmUЬn!P_s:`߲:){I1WD1QJ|O_sQlOVGPhHGۨoE"]Skj|{^ꝬScV-/F-j >^:Y [^n~FqwEu$qM!=GH OjIm>w1 *փΘ $ ; .#T>քgSMg-QO)?Ooi97/BZ䔷|=ڔ1hk_YX _K_?zkRr${pGNV:j@c=eXՑ,L&ooo7PhW? \9MkȬvol A :܇ l! /@2a9bg.FQ,\x-[u$PqF{~~]#TD1 A#kU$6)'"'fPVSGgcP&/cRdqvx3?ˤ#44McG!]YIbо&WRAeTQL%PM`~c3qLFpOd1D/Lf%"d;y-iX=z.ևwvgǽU2<cO} `V3~D-v& +0f"Lol8.Mx,%,HX{,}V'\f3 ȭDZ.S|MqUfܰ)ƖӄYpvv0e¤ugmWeMO0.:(ܰ7_'<w^F;3oHj!&0V? oP)4۵iZB}zV=^c V=Orn8nۍE 6Ƣ<,픭]d֊Ob?);wz^ ƵO=;xm}DrԎC˓0cKXztZ%~c#ho 4nwQ"N4. U6`K=#.C]ȣK);ЖZ LEVRPMH;ևP/OC[@:~Ln>K;F!%)niSB2AI#?d5&QR. Qd$* 5ᮦd6gt"YO$^dƐܝ$`fC\g%>݋(&mK:^$w]9%D[H^ΰ'%c/ { R6A)eN3OTB,=S7J[I #-0Փ?noI?eO dx,67f+>0E׮#B!OH(nf,0Vja_ M1Q"pu;~[B1q'D C,UUCdYGϱwt`˥cW˸娇U52?;& `-_#_G^cvkGc]%;rTN0z* ?c);&3*x AЖH(Q3y3hޭkmcy5anBԨ/9XPMK)piD0Ȳ"܁glbɮ[H&XVCX`?&A\`-i3BfXHAIi8G*p|=q j`P,BJgB"@ ZȨ\QNsHa(Q{+J2/ O V6GY75C. (p_r.\nxZ;uQ =BM Bi?+,K +3(60ϒIԪvi&O*iD-ZA—"#TK 7yI+MeW8LX7kPVmu\MS;QTl:u˗!v=nm\ QGKkk+j>nHjѐyT'CY@oIZkcJS-Tw6>.V㊨2JOڒ(vNPIdʑaPosJ_Q4e{HJFҎ@T/8L1(͖P<օ hC }WU|3ã~M좬$SRKM^Υ? hhF?"XZo8:Q8!"+፯oN!?ꎈL~ա p'$oPZK휋=Suo>r1CD6z3W`;`>@)ͳYi$D{LU/&ƵD'@i:4qMv|_ r%">reiHǧ!O:Sy_9\ a刉e#lkRW1*"oJSLbXє~YHf/ G.81P1ς63f7 Ʋ"+zyQCg2 R ƨ* 8>g }M6aބSL?z>k)Ʉ֦.`ZGY(?K0 Xd񠊵ST `qX}~`J ̋-+#gX:0YL)SYU[ kl'w}tӆ=Qg3*LYQX -z@#-Sbޓ#FT 0LQEz5L櫓 JypT=㧴n).<ϒDיZgW3KN[Q) eU[d(׵2j\#1OEhI.Լbl*Xl~IC#q[/:vL;?2m"[:::OB; [c1/H70'em }-)ƈ{Un[s&dDuVE΢2[TL+]C=P:i$KUz-*[||U>J'B}-ŵ8:MCFvy"HوKT 2B$EwT&a ,qɋx/BFn"*nidSh S'{& ?z jbm5˟Fz~'wOpRr٬5JS ]"?*f\k'lv }F:N8c QX5m8s5 pQxOht4*H-hFth\V:_֒ l c=Tr0`GdDE9aPC_ N4)vyk.niX.tͫ ;`!+Y:.Z'0*p9?YyU*/ZKVdaٿE7 ^Ckl%,c>si.!gN(j eN VA-թ)W)<Ǧ% l**밄yr\˴̏P#>:A\/÷16Vr3_!ӃmpZ:ʔxIbV~;.a"hSv~Vޗ "Ω?%NƥRhPP:?fע=}G3W !P&h en<2^C,(2@%]|f:fڢ?oaL? DP@8 n8=~t@ex'1MٸIB{{bNy>a$_a'WӇ``ȷM zU `9Y=1UauKޤvK[ޤĻ{u9Q:IkĿH"98\M1 SnL{O'xCFj,-LCDqaԿY3-0Z==;+cg h~8;s1ZV-u2$XsjRXA*S'f2 &V)i<n -rTrA%TCdJ1U^j~؋ۑW,`6qfx8roa|NU7we=ҏUo%~Bx>O [kǯ?RfNceJrhNHԫ|JL^J~>T÷\ swrHMV+CFr_MRY,W m_LI宖_Z,j?:lX|T_[J&} FxXsByP+QL5/ b^efI bw;_3^Apo/]I00lU=uB8s; bnR]>(klo8^n j!nG^\]\܀6/b\2SvU|TUy6wX!f7%!euPlr1>yH_? 6Αk8_ҡ;^'|^XpO5貘*`Gz Hfr9=0:Jm՗QPtwMot&'lo *h&`kK^*vHΘ`Ɍ&3sOnrIeNU2:% k[#Cq,vM*\N-oTJµ^6#WvCs_P'R1q44P{թ^@wTvy6r9Y2 #m^cKp;?-r:7RmCq 3ƑKCvS(ldi ̣MdYcG_ʜH nJyEk("nG}bTϢ%[6{M+y cW6\goAM _J TY^yکDV\f;Mioz 5g_n޸Sdh(Ǿme\Ξ0婺? eI<'u2Lr/PM/#kE=O,E(,-_8[nsb!gwoiu5t Z|u}2FsY$vj^(? ɑRdK5⍶zA/ BlVuU\p)+^?~4M2fr(c yh7P Supk 6C8pW :?ל'TǙdiyrkt3'\ lIڮ+Tul>ڰY:tsMAYjj5?G>LY9Z!I5s;fcc[O!oy?CV{%h&Ej$Y~$^z$)^)OoH)Jq?OmOފ9զ[8nWcs5Mz6Sf*Ǘ+0a#z 3mgsEu[YW4yBCĦ #fxKC6;N1ո` 1'Epy| t9ϴx`e*ByJ5">eoV0<g)vFwD{Z=.H8,)^N EsoOy4ܨsZs_qZy8_E$1tK'Vx+¶2 h&[&l8vh22t}UY[sD[V:Zu mUZ\d?SU+k9Gv3-e']aN56;5u~+Ļ79^!t, )F`pŽhs;"a>>O8yi7NXd" n)4}yf>7=FȎJ.Ll$Qaa`m1{c9y;T?%E\AUeS 3=;vi{O7O ;@ǵ3rjȂ(㴆`SRtpkrEGY Yk fUJPQN$})Nh<5~Lo`¼b M2d1O %/zəd 7(GkZ Kk;D6 WթMJfU U_r{1)z.G>:z1q fg>EVF`)ȭlz>5,eI&*\f% zl5k|(5kICT`>sV8]D".LM9yybމuZ ]mⴻ*mp-̆Φ!m%Q`}3b<Y"-5FĂu!1nG16x_҆e~]5 t30Eiyjgj5'9oP Z:NRr3bbD'hzȌN5[y̼]px3}랜D$Ls jX$UQYp[?v6e:潃&W/: .4xn@ǃϢjz>rm .:I kwI^v4WQuԯv%F!uJԖV'u&4g p҇Z٧ #7\ț[jApBn0]I9 nZ@T6۲v$P?b)ˌ84bыjRH*'<7-E6Rd.ilbeB?VsҍZY _ B7#0IxUH'ٴKGkɶE.Qsi itZΉVPkd`&@AOHp&t㒷Xz;8}_=1:L"θ&02VaV?-2a KOV5dƠ/Į5 HVd~*Upp>s ?}Xu%82?o5Z cN/ƼWg7e_&$W%xgډw3"{y}*2%hlI@ڄO1}a4qʕn 9$J\F8=+3ϪYMܭHkau_v3qirsmWv]J \ WkHH莃w婆29['ߐ覻(`D71_L^'mnЎ=/Ī3~T,-eܮS2zweÌlEF #i7zQ;mabW2JzSh?i3ZN-MSw-f(ln1ŬΣ  vWPc"UOkI`*H >M)4DL|tjO[O:h(fn{T\$BPe̥>R;$Xq/朶D]A7僤uR,tќdj#AZAdj8Agv᩿?1,p@:J K8c!_VD$ _wq\R"E^g[xtM cfm~3ENid)tr:Ef(%ҹ6bEfDtnuqG9)@&O%SaU܇ЌփԶ6sEh1<uib WmA+eF;JgWPI\ɉ*Ybr}?HO,k)^%$]Fԗ䫉;*>JGH^I, ]l q*q+|C.InY j$GP~yQKS՜&'by$fj/Y Mq =o1z冇 U_Q!]ף mțmXvע#1)íj1 lƜZ%Dl&6,d"&#'YV(O5 &kf|Oxvm ECƖٌv=@`X cvi3qߑZgp~! mΠEvziIsZlզ|=̒E:+zQmxGq5AnN͓R;(Bll-F=3C՗_I=:`|PZE嶻fִ˩)Nk],"2 E?`T1Qr33jce8BL;6E<'+*icz W4wv0\?a]rˍ@'&dq!gq <^ ؉Q^n~7m`qw`]X⟭! Z,m,~L';jRfN6sdrt eF8Y%PxPRXe ~/t\  p: .Z q飬7x. |T-[893c{3 `9OŜzv6TKg캴,s;f' NezC(%Vq#30n1gqgqJj()bD=5FM!pҙ_ Yg= \fP*g=U g_b*gS%_MAT{81KX)LݞUUX=WWU<.o3OiFb :㥊#Q^D/>9Bf1Y3XGX`aLI}1vg tb{mɁW~K9`C{) QnBִLRf*mL :*[nɘ0J+7F,F*Z%x)l|ohzJJ 8@~;Ƥ"D;?&J>+/OżkD7IaW̽C6eA44@$pbLӰ*cyCboj.&%#ߍ󹗩n˩䜭1&5#R:Ib?Pch]Y1=` ?9wQu{!?y8za+t{ $̩{q]j)[ ً[7u7*;aa]G,UbMwh3"_T,$?.l+9ǿ¿E-̹ gZߕM:^صǧ=+Jk԰i.-Yg8cr.EAO\ X?v_HoQɛ'U(`a'e>R*йVr }ۆ.fǛCN5TFAp=`ģ< 1>XIv3U\_`sKJ;MLu'T.@LߐN ,1U5_dָ[affz|LCJ!2bv[47Tzƒ),-WvDl^I4-CآRAS${#5i܊oJk.Hϋ_iBDޏ]ٌüz Y%a|ؕy.P<#X<,{f17@LS(w4޹x^)2J2Ƶ ^r:a|q95f3<GcTd]JK)|#Slf[Ɂ,ԸBk_AS*IUUL*>mD8alma|"IJ}t-Oև?fV[7IVxEX͙խjf:e{W~/&)J ;ގ:]YrK:H|cm6!'ڏ^%\j {Ipj`ݗT֡;fHypqQҦ֜7'&W4Tc~d([01f=5y=MEg-жzuWtg 4z+pJxh;Z^y 0! '  UBu-؂wR\|]<32iU86K;dtqmU܂7m)ʍ/tkk@(j%J"l#R_+h6LQ\nPM*RQS{SWhk(j2ge<0JO H"V Ӷ'&Wv֧3j>1bk={ fY֖Ŧs@mv/4Jғ4S6S T .cgZ/*`^ͻ V@V@[ᜤVk'=/vJM~L\%\i!-:?e7SӮ3M=Ր+f"w{_)K ֈ.XK8fZЮ~n럮::Ʒ Sh۲\HwQۄbǗcrkǓs,izdQSke{Ꝓh^il^~V3VwqѳQ sulÙdWzlD"`~!˳oQKQ-1 Ќ*b]Vc;Nh.$&&jO 32[{vZtC崿Zms`uu—?)Hs@0Lj<]iӍO2J ñ "?&5l".U4{jI=$Ueb[0[OivR% QcmFꏐK4 M }K*۞eY$́ rfxV҃geםj~1=`rGcƁ]#r>Sm>g:N[™8\ww9M*uH6|G]^5w)S:21#b*UeMQ]w qAL{n >_/[sk-m 3m W9M75[^~c vm-ЁEpQ$({' q&GYؑ>@=$^`gkzy;FkmAk FX?/ʧot (t#%!ݽݝ׵ bww޶8^ݙgahm?YY.Pq0W.[ /aP_/9<{D}sld0M{al T\HC?QVIblx8w8pə,Vݽ[8; o` z'@7|p&.;GwU \O-|ݣܱk3+W4H~|٩HŠ5|TDC~rA\r?ȱKb^7O6?Et!@K қ39%+#ij[176qђ^jQh&rc:Y^@WYVg=^JL/x,^y`LGɿ+W-sB(\.,wp8Pnx<4II7ݑR7ZA7ϑvf7׹'N[#1\Y7Z}u%%ZE:M-77 _`hdq먜bZb"X9ҹBHƲv)^FZzkOGc ٙq#{w[HniR|6&I`"R -QM-E-UX$22v+oD_`&;OSF-0@70&"3Dd=dA#v1T d, 9& ﰇY:UϚHm5u+P*w㖔D8_}9 3H8\oh,eh \|}.L"_Ox%=!~ =ى>%so)M7MWvʨ-^].JۈHPM={Ԫ{#*mⴢyo[{Dm@_cf3ަ5k,WvhC ?<.l#Ҧ3B͝c]_kېCM[ 8t˩v5h>u!`$8e ~XX\] ο5C3eh}Z:9F,{s(Be ݜysdtTjLjikpKJc kgS)+ĪЇc=1yd%s =0@~/ 9|'FFaY%$` ! iEn?i{,Q>Ϭzbpw"?8چhNÈؿ̔U ̡gV  MkLa>0SlQ8Gg6 yChDpa^r,R"R vu` 9j-٧mOZs)W5o -jj,G O1ƂCɳXW3NOscVXRgTrqo| .eSF*rHZa,:JJl,>=+zK2'6p׺wV={ID~vC$UI0`*v[)Re P$R{G] ̐uMItWp$zᖂiUXY bLJ*:o6YMd/CTou8s`kW䄺5Ig*$;hӦӦ9c(m-={ 8Po)qlhS9Tuz%4 Y3X)YYj|OFGP? To`2jWR ZAwŝta^l$N 'o /%/&,*zK>+vS/ \,cmx+;B$!I\B$ֹ,HyOIO)OVP]|jch+]-iAI8m?Dϭ]FJE<€'`IGo& .HI XQ_`v- X-,)l6 k@x%@ ڭG<,$Iw.e$p΂Ao՚`$VwBB j,Bp 7(ə_, ,_Iē%Jgبz5@nC*Iap1Ó:y9&xKw56%CX.x^[z+[M9 A.MI}l$+R\o屁S$3:rS~o|4Li08H!!^jU`j:f=Į՞؂W8d-dЫWLCq.^tQAYE?tߚ,vQ\Fgv?^{wJilP~gˌT1/=CMy+#Yfٸbـ*U[-o. zURƟ>n2ӡHbo?,*0AM !e!.ʪU:[92tͣF/=w abdLba/˚QqP d%^ubƐ֙~c| RQͭ4t.3>HQ2EҟP3+ev0, /4i?%uL|8PZ(Ӵ̲;Ճԫm4(#+cq7i1V` LɁ}"bo$JRӌ7KL(-T@n1p >UP7UR/r0SF4 =C+ΆBz U{Ti dʾK;TjI3E|-Lt?:|C>%A@޼6ݧacvltinuHTcܰ@,AܤxnKۣΐl.eRwdqu"Y1__Guaz;$-v&OiHRODz4qKI>ZECL Δ\>#B" A3B $w|&UjN}LLكv݂)a`Sj\ݚȺQ"_Ä76ڞ EgjCDߢ?As/5 rη?d `C2'Zc ?f>DYD0^-'fLmpu2Ja{῀[z-r1t@ˈ |9!6i&isl[jn2;}?α#quh•xbƪ>v:I.&5fS.;@* {#WÌ#8| z" ϐ0iޫ,XGYat,+AXgMCXoYi%)f$\`$VA3,rM + oJ;;2ˌdC|ƙAn?%)c+Nr^G{/K.{Lݛ|%}c4pc|#;|+n˨,{aV#y6CKLش`"*9*\ |7 #Re3?A.ZI)~aL`T:Uo`Q]2wW林_Z(ެ+FG=1)G>ZSvΫt:r74ԤXIZ2{V,렢~4H8Czy J`GKe?BD5#VumOH)Bޭԣ\*Bkv^sHk48y-t>[ѪΡʗ{,jbo~hu;@k͞myk%J:xKXwۡThrIߓ'pD 1{>Obm?o)lA(==\( faTD[MVTY9#yĤ*R'mYAz퀒1SMyp6ey1x|Mʏ\,)$8DznP4spQ3<a?Eȳ#"Q.҃gP2'@HDp"iA8tax!0>eqp1ɅqF„21`9+(! V;  m $EUp/ז$0Q\_} rIƃ`30Lǰ7rMl=LH<x#H"jnc>u´8Dc36FɎ粮]Lr#X u4=ʂdeZ]p+v`/gHAX$VhXG$.YL}^iíg(.C8뼮v'kmQ%2\XϱYJx"cҾ.0 er,a5iJXry[e!}3Ya8tGMo_ȸ-`ZǬO 'v`w2_3G׌0**&ol5me+=G4y t)ȴffԵvho[jN/ 6ni,xOLy; k v `ZKiMȃ`7e.+m_!qlB3]EsʄpwղITiEDm?$MŊ& Uz#|a6εZ%yN :e4{EMyR+S3*C BwQ$ܪsrʥ˂I;mȵNsӈzIqQ zX9J=F|^Вqh A 3'<"߉Z:eke Hĥ`*VDMJ0 *s?n|]E\9Ax`I*҄M΂¬k9_xXG[dW[ʶ̣SN%ᗰM)o,?{e9<6y{^"\M]f+] zj.>]CWv5𣵁e-فvMշ\uzla A/mFc40M}Sc DCJA?[n{D"lyKr=xFEG#,hIrɐnq,灨 Y"ӟ J\W_4)7TY+<9?<=_/>TL]x[}vym &[yk91`/|WܴN?Xe'5?&Ԥ'>wUW"LEއ/8)jY%g}hOMOwzG~Չh Ky$ "NW#䷂d|2d&@a-p!/3HZL);(~ L3m^[*Th:*;?dﭿpD t\n;4pD~YV~ZqS/)u(~ƭ+18E~ɷv>3R-69>׺3-9{-ۨ)]o!ۗ(DNx:k?6+wB1XGn/][Eg3+R$*jKG3xUs[9_݇wrTz/ȮS (6@4S"Z֭N}Xg]컨LwG@2|a鍵:rgBsN^ۑQ|MHR$j\",eR'UVF1F/m{pL?5X#ϰS6t+y;Ke[IoGCTOr/!0:ԺKXE*6hl`z;t߮H Vub֪.>ZdTˇ9.#4jŐ <0^rypo:ԗuwtͦ4/=f2qIȨ /[o-@5h^< {~o{.~])*r]0Xjm*֍]) Gbz?$j(5.3T`MY,^O߫+FKHo m$?B Q$O^ʢOvhUAW;}顾 }y.Fg& A'c>(b&eaM fwY#A:/_'+{EuP?wrgvSbvUM9U$sϑ3mo5ڱk͔W1_&&C~FPܷ0q2kqO)qq<^d pRS_Q̈׬t)GC? p:4Fy{ۙibn[ ~ cH]b́$>"&L^j⮈g/A!jƁI%&CԒcbFY鐜;?CkqFo[m`ڈ;D&L%0OOLʌ4I^>c5Rb˔S;w<ԆLnK߀ɿ|V]kl)hp8@~{w]q u\95\SC=KOd1-2mCƞ]f TN'w_ LHիK#Ah`$%X'}Yb챠st;m˜~{1q=A:|EՇc*ߤåJ|tހL Vx Nƚ9G^"%~;(oYcYqlZd54"8SsWجqy[Lbyfl+J?E bǖf"Xz }YEanY{>Gt O74PFl.kER[hV~ecS aqĭ$&y}u_φ5E08&mKpٸې2f%F4+ބVEՑq!')87D2m-5ǃ&dqL,Z`7ɩ: i{p+c&2ݲQ`KA8v|c٥MDeՄ}q~]4z>=e)2}my]4SQ({RxSF5:xhl!m%"F>o&DpYGm^\$WHzU+eBvz_w*ʮZƘ6`)£aD}S ۷ZźB\tlph6o,kSpFQOkYkk1M#YyZ KԶG"At́.QXc0 ;}5}1ߢkZЋ17,řBH5 j[q3r ]T&I-k0HM*4B\.*߃'l \vq@;soԸty)O5rt 5j6#UfHb2//AK{JI<6e»7ShX_{j P}Kj:=v5Y.Κn8+U!{ =r~蝬*<)Sk9Q?>7-jhjk+nB6>wL&"Vk.s w-yCdk05[?W f@sp0BG;hy L>^Pw|+>a7|RCtl뫊"BW~)PpQLAF5m{2ZZaaַ%\>9 >(tV 1C}A5- Gl-O gpP i\ @KTU_#g*Fń7e+W*ķ/eU4YB #Y.$a]#^Dž!?@#C1)Vƭb.{h += MmebmX1984 ?F㥬q>no+/k>drЏڦc\R``9/`q5Ήqz8/%}:j|Ds K=1 |hk$Y"%C݈]RI2s9\t[f:e y<ݸvRZ[ Ч$,b'Qa9^&^R߽Qmv)Pȼδ_GY~SM{ԪzOb"OdR-]:wiNMyZ3 jo?RZћY<u'MD5Hj?1u%ldyUM>Smk ݊"нEQ>o]GQ_:>;EqVH'Q^7QԆfxca[j}Z+6m-+|$r.@`X`;3(,*Q7∧ZNPw8(3|Oymuj5O+̗BUS֤DVH<A $"'+}u7I^‡dTw Bcx7@6sPA.vX#pb:'\!a#Lo'}K@.;$JJr.u=- IYM;njG0^y('Z98n'n4}lq-9q39,W,9hf#7 |E@; x; )I`wx1}t3 a)dJm=칈NW|QTGs몃07s. ɛGarZ 'D(iB%q:z :T!4(|KM& fJɡ8PR&e>~Ţ^mBOG6ܕqKȓ/њuڤ؋Jǰ&YL5륀 ?)(#$M-N7'&  $8w! JSK$>{U5xYx=8/ܾjr.TG64\\ ŗʤc$V,ŏ H'ŦAZ*rAn:nEc}EX m xzkqϸ@Q|"V R(4&jлK0g!{{4/q/v?@u @Ψ/ Uq#m/кDLBǤደj 䌁e 򅾅9^dVW\;5\GVzPcm%&ۜD[dō eyvO* 7 onv!1 5Z+@p _ ,NohQv g!MYO Iւ pA4i) kpJ`$\2sF]uoJ+ά|Zʟ- ;ۆ7Yc w֮g_9jF6u}3?SX {Y}C&JʹKp) qu)a Cjvfj^ߜu2!G }DZ?,>f୻A8sppMCsTփj<ܢ8pc%\\RJ@Q%hQg4l(0exyS]l.tsse"ȹ8p.3$ or[c+9M`?2[,ُU[Dc"lpsv0%9;Mp7*P/\o`8.va] *i͙lKe~9BY@aoJWvɮXcҿ!,4׌5¬bf[@6*?YΞQVN]Ict X|9C!/e-%b!$00s>3d7937d0ELyxcV}3sԇ1*0}EaA2U_k&k-*jmMS y;d/~x!C=dh;b@C0OS>ڙQ~߲}1ӈ;$Q%U%&\E~'0酐Jy{tcE4l|7Gf4[U(5G)`ά^<"-T '2 ɥ'y9e:\@ʐ>"Rm>$y5 :)a ULO0}M"z(2QZi?ڏă4)l7RVbs+NLIVYYE_djyHqpEI>+|E.|a϶g;AGTvs%*[n&vԄIJK7y1"2((ؘyȩʫg%p޻lCޛ=٘o JR1w}\=p /Mk ~qN٢tIG&gINJU"h@*z EDŽN旹|W` Ji r(P!# >*|#߷4SB:J#˯3\Uu/|"=;I8|@\= *<j- Oy[=xM ̳p/]Хu{%h,(g3'ҍ98wAaF>%~}k_rJzԚ.L8vYt&I+P5Iuv^dbc_M8=A z}7R"nu`hqat$#/%9][mZfASfDv{CUC:CVzF[֬e,Q~dU@ m1U D=0(v7J׾ha1.9XMq0gaKIQM㸨&(;D)r\'2^v_1_de︱vH[lE+_)[0zm5vi#*zxDBD D t9FM"..o7*V#Jc8 пRfWFv7C 8ׁ% ~X_{G}7%\.ZZ}OT n0;} #\coӲV}>Cmm8 Ŝcz_ӁESFa[f;tMlۯ+ԨBKiK:u/uwM]& ~kdϬs*US1}ު瓖mU9X]%煅p*4֢-;on<4XE1ͺa~TRo}W2~N;@5Sl!,+s `=2sx4&}zcbAXsTl2馩P7Mg~iHVnqi@<8+Hsr}z\`ݛduz̳rL^$ ˤESMЊ=830AD рvwi6i`z2#nM* aa*9o[댥RYzް.mqdnjwmqnF`pǠO5w(0:|(`7y ṞM3Vݗ46/_m2uZښ%{S^ (._~0xgK ղmt9@@'<,B.jϣlgHѝLeL =˴u _*=DQYx?f&9-KSr2&ڣѓ30<[^lHCPb y=nU:Sx!ԳQۯŁ䍏k4T +3ĆNrD W="%MY̤Ra %ΘPy/4>v؎\tΛ@{ 돎/iOA9 ~ɯ&$$$¶3MxLNCm -n]Ak-\a̩kTTunW/XNEº9g Y[LU3F¸Yedn&86)Q»AԇE#( Yc*>{@vSmwXq*;%ϓ3\0ΝL%LMXc\Aյu1Ju'zCT 0r,6}QaM? b8= !!sA!q?5LF\g39Z։ 'ce(53"}Y]AyM|rR>ѥ-L%qA1 9 w|f^lìD/8C)AcF@ywi21&+4yi:ݎbeyN֝_͹( >d*ثvWBDJ ٘,$". OdEu3䮉MeŬ^ʹ7G"G00-zCugL8PJ! 7q e \~IO() 9g50ѝZ&H[bkcإbE$7*6C$9 ʬWI_eH,oM}+}S=N)^(=Jg J/r#l{$)VOzJ\YXEnQNxjKަ">aДo2+@sLsϡ+f^?Lm3=/Zu|Zdh( th:]bӺd_V#Vb" ~'mN?L!.)E=gI>^FWO/P]9ip r)a-I#˫ ȧ,f|I͠Kcٽk;Bw;[ڎ Z;HKS  U*č4}/ D|xf\zs +:N> h %NؕcR#N^ʇQYdrҪ%o%]A=cF(c?F TN5T(EyKD&ʕg7m0AX|:M}D%ˆ3qyA];͔Mp56o,,ְ?-ƍu0b^(.bXux9sRxE{?fuDT&h8'e1{ {9˅eeXnJ[D"|? 瓁/U6ހ5C w7O Չӄ޲ĹAouJe1w'*XW.lgsv1fؖ G>uT{p5b []<"ve*{)3|X9NH)51b.@Pu0TLh2 }|< $Ϡ>CB'ܞi9.$HW(%}t.Z:DȜS'Uf")qۥhRg?it>B%\0rCO\=K2B]-dH3uH2BK޳|΀ N_@8fU JE_qSV#X f[;8Mֽu8.x*7-oc 7C3}1B n-&!#ڎ_!bl0|M>{oSkywʬ7MĥHzo%JeHe󒎥7^CZ0Ze$CEgh2`9M"0wHĺ:8zB(dE=R$V/{ Y6* O!i[ه} bJnA.GzFg|"j@eM=M<|͜0HYS?u $IK+uO^db))TTd<_+28Mwd-H`/,TqjlPj X,?ܟ v!roNi&4Uvw^YDbk.܎}eJv0lWY-oMg-_tk)5|,"i#$~`@([*nH;DHiZ$a)Ŵ F:` 7sj^xyY}4¼֋nj~u|ܾdݼ^>p=<W~҆8^ M k3…'LDq iT5ON?\;eZYW=+P%i~&-f¢ Gs \rZ];Bp>1?EDԾمZTz4Wk1e{ȤTLujmv T*wKM.-_MqUӌ&`$Un/LHE=۩OWf2#+5Xk2g8 BL1 Q5h"ڄn'}07Q&eևU륩e.Qoٟ$BpTܨڬۋtޜ CBiLb'~ B0[ipUOyh>8|=k"A`&ID"'Q/iUJwU<7:+鱕΢6C#?0K,/ց3ke'tPY.tѽ|t@V0^0A֛QWWC;V=6vf6I{'7_-Yao ceͭkFa C{I蘠.I\& R+{jFc瘺4GuӆO l"L.Au}DW6 Ŵ٦Gk!kFK#Q.yA *m@ /~o@D{oUP9jٳea%SwRQGUwa%Aw*w(MK%WǧS'GhhLƘw?Vs-uBJ:6㊟Ϥ|U^5SVq-$W[A[boa wkYiUM,s iU1p1d4GY}u1Fo_P¿}@7(trRl+=$|/v4r RS[Cwq D2B ?hg!7U%f*b]> AjZ&,-9FPhh04ɋCi 3I$u 8ON6َ,, !t_ZTc)YqM:w6|N9~)T=QΘPب([*[/&^ ͣ͟:ͳd^[R5u+_?No] -oXaJ=Wd![RL#&.@k QW4C@K0O*]"@9ƥ֦u.`!kudX+|q0qw|7l9Gn#RDc? >̟늃 \v5vDJ\" Uqs[@٣'"~G 8D4 -w#e)-Sy|KZXS@QT̟֍n'c!F\~BO0ѯsN0:p˵B f'f?N^2&57/ш=C`ycrS96'7 bh_C, !p&#{h3cEݑ4CcH!wdSo>oT0WHnIb,Ъ׹P(IԳԭrD:]r.BKhl:4mMpw BS5ԺHaRdJoGxAg*oY㱮.~gZx*7 A:H™lhT`ڵf#hjO&-v9%VR b#Hx/%a}K+_+OWR~^>ԄVZ?+hHM]Lyx*l{Q.k݄!̼$Mu+j Qka"hxeL]G|Z> AX\^b @yrPA9j`+\}?Ym\7R" uI]]_,iq|X4&˲rTmK6߄h mɡRYw zE]q= #6ö&PuJӮB"%:“[cPSѲzVgRgaa!߰Ʃ~Mj`{@D= ;t5)锥3ͤI8/!r{;ۂa7.%f &>wcv&a?D#BVROLj.Mw 67@zy`X>#?l*0B.GsHIυ" r)WYvM-Y2v ًOzMBp j-,)gKfDaMIdn/Sam gіլc,~}m\0dŤ]Pc$S1O±I$`8_tRW+#ikE2;Zc;.^v,kWr`kq4xQL2oU{-5tS#i)mfej,0IJ F7JL:EX$g~l@Jb FWu|TVwyyo&aJ=N%D|9ڤ)][-Z U uy'a7ND.+, I6yWf3ս.BcÜvGp;8kҿ {5o Ǜa=o9nv?H1/۾?jT~=~QS%**ehao_1ӜW;ڲpEs=; 1Ɠć9+oU b8$7>d<"^a%ڴ&0(Z{a}r A\h&z*w6`N§l rY6PfROv?B(2URcn ߚ+؜,*>~&}v;AdFN[_ ^Raϔ .D7=RN{Ycsl ̻e$;v\SNGyiM} c`,)iƢpd sdZ4HtYl?- p76n 읐ٴ>,ۊz vm}|oDFl)'ilW)FR CR"lYZ{\PTI}֠y[ ^5؉-{4lBTqCSuzc7leSYCb)ĮP{ƑO[sIp3mmMƲ]RCX)wJDnYǵkcirҾ.Wבo3W5 1pZ^Au4hޱ҈:k+⺩/X| dpOZWsVsj ލ sqPbO mC7Kz.fFDD ~6z%\sZ工}~7+uAB|z2sTriBzgc-DϜ^H4[& ANrBA{ =$`( RR|} 81;F҅V*4JZ5p9E >D.?H5n%iWϥ a1&8LKP#C[ReLvi] <=BGӾR)gY@`Ѧ\&'J3|/ЩBftGUUF̞Gt0$\zzJ4s8:?xB..)}a?dd j00-X.\-%%nOm`yGD~u]C6Mmy[b^q,(MlL=n'2%o}IetF'U &}Ev*7~BPA=S dwMKh wr;KoQ*sچRj e V 6}cò9 \1ۿgGit 0&VՍ|@qhhhc:ы\D`CI 69-.s߄@ Q Xq:L)Qr!څ7k;s:x*oĢ^إxM!!W9-#[{q5X? 'o,)^G\${$;@ɔfɾNfmm;WsaWtPC]UsAdw@SM" %Ip7rF ^30^ȜIB5 =*LZ!#";͒JpXwyP`!0HXiD:w7kBGQؗ=0g?ě&%r1fz-JP$LH9*v\),,j fŊV#+ڧBL#p,9II_cm t^}d޳6΢(Ef-&rP8FQ|J) <'?͎@ڬ85>ج/r<1C}' QWRtQtAatod឵2O,nUO#/->i@F#pTYb;BR9@Di9^!~WI)f,3Xy ]yQ X:KHQg, ũ@eB6pIfYWK(2ӲE_i@wl-C \ 7bky$qǑ.N#JO6&JoT +SI)i)aqc׍)᝟s&ZoI#X+M}4 {*ZI9{Ci5`"ց֢IOSY2(7L*?6KPL~FR qAU9-6-AB!QyR=*"6F#+ز\g$AaWroEq"m:.iT78<+E%Z.)|z-*$۞pCԇ~$aF~:@.La}tL SKū2:EZ xu-m=KbWX09g`|.yH8$*[8B rMe<"ªs8*s?%LHͭ8(A5ϸp<zRvo)cnr?;ʊ]d-@qԞ8JI@_T3vgjRvzq 'MN]K̫G9n x ^XQ !9$=Z{w1 zNV ec 99ȍOA.\0 yVBI%f<=LzDH`UGg9t/#t+^#⭠rS.hJ=\S5LSdOlϊa`.Y ]d2kXTWKBuS%Tz)Ͼyqoz%7:[B}ӑy`2"#qƙAaw7"' ?I l_u֖s[5皽+vkچ ~ŝ~2{TX9*Hu{(l7QOפm6+ Jcxe~SAly4EQ1UgT(B) N>̰@+vLXO}dRP>OV6*u ʦ6#K $#Q޻t'8_Im4Ԇ:1KT2wY ڒAo0M0nR+ |ϳZjR֪.tt%ݩ7L<$8V%odqusĿCZ/!* ^cͽ,RkDUAnFX&0Ovn /F$/_'s#kHx>%K׹t_j+,a¸0ӈp,7TOe>G0Qӄpx]*_K$BW', %13*^\6I^g""'*SOX*[Z,+QT^ eLS̷]ȸG(heqiY,msZ:G I3K#)(բ.{$$#r,.PZJ^7~3ogt򹳺 Lz6w1oOu}̋KQ{nX^˶y&no)lYa448P׷XbոΒ$!3sAi``W գBaOE/OF *& #)JGBƸU&gqT崸"v<۷prjS/Hz yT gojw  #`S)ʧv{ X4q>aooEEK#>2͢yNBMjkX= zNDΛGrtS=nR=/h"}njy#7#a1mMe(Té+ b-Hr TOtܮfYK4"ܒddN' Qba(^g')PSƹє\Kd6*2TBMtu uJ\- :>ZCIvjJwI!C])e @Wu]]1sU;ɎujaBŽUtѮ'>s|T6gvcyRR*Bа)&ߓN G;Ʈ `㓳@%Tv/Tg 9{j;F%vҡJRqFf^,$mm$=#*C1_'k_vhRO^^Yb,@aZm(,uݐ [֬P劉Z_ٓؓ3\z'%9?(w5}Jbc`xFJ(||:cVRNFR6 nn/9)-2ހD^eݍEoO vNm|јфe=3zbiރq[Wj QzBt193NU&z%$NW&\ #2dl#n )+$`OB4"|* 8 zB~[m *L*ySBe eQiR*eڒ-=L؇xtPOn[ƻtNwlsl*{"%ъaBa+Kd:e%0Ƶ䀶t5( : )|E)ATc#ژ(YCUqӌ28eZEm5"d=.vh ~E[|2~nU5~atJtn*% 1dZ5E;ٶkN =H켯_ v'2ۊ\S$3Ɂ= X M>Ƥt5Jܒ`/THDKxjvkJY\fPFA>)N{"@}Kqa뎒 v z=YS>?(IU*?:1O'(z4/5[AH Vxam). uVW(_?WC`n)"gfP3tIBb6-)OzhP<ީ~jGVƺZB$ؗ5%CUS=֗#e|eBȻV첢BFl[.lAׄ3H%*:.j'bX\0?0a?0 #22ZS*^nCaܶ+1W#˴we(& AcFo>D̤n;e.Y9o ֟/C\8"S`͈oԠ܉ONe:"0" R<]e)VO 4LT% braESpR (\-w{vvR{U!'mje8#Qm%2nK@$=Tr͙mq4W 3  LXm#t(ebLɞd4PR9n @:%AuTm'6/O%=SMR[<'{(1Q,X .AS1F>yQ.̧tÏ(̜D{P(R7DSY*UB|7TXoD!p6u9qc5F/Xep N [#7W 'F-)]K:Y|>13^WfVDa()eȝ_1SC/'tESrwpk+UH\f5 6W/Q:y`q}݅Jx٣_bVh#wKd\Mw;8$Dߘ %nB`aŧ?R46n+ʋ)V /^(A}*JU!AeoH29E9 yVnqcdd檃dB@@D_ wl^`{¦qHcŊP(WMTu?)gie²P9)ag"~ e/o[U42JFvXQGPؒKn_΢Tj|mȏP0mEyXqpJ' R_!ʃAd;— V=x &Fl}kߐ&k\"ZK|#,yB*Q97"kU &Л_mN-R3i9:4=WF^3mF!cAa<U9Ja Y?M/KrR8P ESl%Wp.M?Zk0/m^*e|Qm|Z2-o\d)]5OU3T5mE0s8s횜٦)l,~NW3Je5]Ȃ/bǡ C"R>JM[k?]^y0y\#%e 䴱ͱ޴ xy=9ߝ*X" w35WBKk8%|zM*m}*D?g)Gx+6"e=_/C\R@V:aM`g!T粊*SA؂hGoz-;]_["eahL9p-qؐDb䲢"Ǩb-p[3hr V {E"B\R# w9r"`\1rwH{@}ɟ KR<~aY+ j:{q{9#Br1$.@&bхJCO ;K.bɥX֗&l P"'/dJ-%q#xx}KTB~[!h HRYB/!'LduRU#v,P^pSzvPFG)c:+~62OuUTD3xiMᷲY1Dr2X4c\|=ѢQ0WI2vfg㟥̄4rxsyo<17RȆ\o.'Wmei `ax!G-S$>).44;.9F\ZJe\g)x2N=CWIOJF%QF!QjR ڙun+s{0fxZ!A^~_SRDX?9 !KR껫sU7wy@h334^ ^;Tv[ gGP\źr/wBX&*vcM"wEAmnPR:@Ce$E+.,T{RJ\.mW{1=P ~hD!kJο6%ʜJUGof?lsH;n }8ozM@۠4Pkp.qCR|"E)v ‚Ƒަ`K{<굝 b: V-o\Rqb8A[ cj#?cՃTsXe֥ؾ,~*{ӻEJ7x#.k_H8t5/ pwڮ ӓRi'J'6Es"L#1xq2=YE Eb y=q`$Vц9x]yu:#WD'&$ϣjq3q&]Ԋpmd PLoK[J؎05Σ4NKPEQ^)xMnIʶ9+l[#eJm^5`:N6)Qcˈz?n$~)4cM)ԟ4L;'%~Uev{R-Oٵ@ S * }̸^^sqi\|[.*68Tj6)!엘=jzw/V\ZLD1Ju|sL|3M1(SGއ( "^}W*@|p$ʩL4F/ upS>VU?4By=. ,7 is#0elCCLEN*rD}-fXIWq=znw;~E7 a:e@ѹ lSO$̕qzh@2ʍ>,ȶCn/lb {ِ '7 GR6%~8p ǡ4඿L H4*W$Yö7GO%OQ=J0Ge⛗;iۼ\YqKhf;<, 45flm 3w6Ɵq1З}9pzk܊KY;/:ȖXX97V8$afOM*WSY bwn`=MwgN Md>M?b¼m&W^VAy;@1H/ /BZ.;=?G?CON]u=s]ڽms۷h~[hLp|,5;JC8Km+" R@2SQxZZ5~ bU%n^!<-@:] n+ki :\$8: $=#Į.kT ?]Pyjh=9Skj̈́;o]ƞBӚ5#SUjo+[pGw/4GS>( ضPmp'3Bd]]`jXB/:\7VrJ.]+?2'X1u<Է&4+b^mۈ{z`+2fE9Wx2۝rlBϬai҃h[ƷF$RecVbE*ΖǒˏB( xJ5~J-VPQGS>BӜTaq!Bn1^xA/z?u9~?|Y17* KjJ|:@5~H=Ͻ1w1C |\"kYotjgҚ[^PLٰ<V(GS<.aΘ4f2ʹwNg`pv=ڝR-LݬqBs{:Nu\ַ& ĵ32(U_aջ`2^vn1)P@]TzoT3(ocJ: U-Xm Ev(pGpHPUdO%a/dEXf7<\ÏtA:VZI@sXv݊%;0uB<=a1#c0F &F ѯR Qȟ$m",BnNZAt#4:QKfq+o{EXxUec(ML ?MLFLyL?ӆYAbm>nD 6Fo')$FC% eVn$:U#ؔW>T; 1-;0ET ll @8CAL0 ^ŨwnVܑC]'}F'ӗ `o- #Y%\  M"N)11as k"kUi/B /Kd]Luz^9Qqڎg UR͏Jd3Te]'fdf*7%+VIP $8Iӎ؜1o^ }tK`].C.,H'si61qpYW)}W۞joӗ-,W`Bap~DMd[TopdlBˉ&HaiT ((,)+I f\STOfG+PO+ceLxs#ыJNȨi}s_ǾU}3o?EyBg kו*GبT;>Q!FIkw;mmFmݥxܶ; 6:g75{r&ov*uNNX?9T<\7rbӸdԔb糪mEyvT"x_N9S~7\r^NRwuzʵ7Wn ~|sq_@Q'6O7<}җ寢_۾Qyw+>D/oAߍswџ J׸]|[pDt4<5lEqU>=֨m&>o?lPnhI),ێeaK:fFvwOshp9Awe8Z+e{{O  A^!a:#F1M$L|-e%Jڕ2e=~.KޯEjvViȭYZr!>X|Qc4E@yES[1˜%,>{so(+, $kj1ugdv`omi;Ӱ+#=p@my(s126:FfS}Sl8g|GG{]^;nw"$3{pv}+W^q3VmlȕAG4=m|V%5 m黼?J_~{я{?zٟiy3>%]k_GSQYZnjfEZn!m٢eUSd_ۖ <40*7m"grTbanaiQ e=[]ޝ;;\us*tsۀ;mwK=h8_[~Ȟ AVk̇6#<#G+HLtHږ9Q} YlJ2R,**6m)++{ Y^,_=!=MH &U1&k.!AJ'gPy4 ¨dXv;g{wJ(&vDKeņ5j+4477Z[=Xi](?2ō59k~i C*@G:[:{Bdܩ7+:?|˄ˋWVb]jqzkΚ1|Sg_~6Vxo?2 =H'i\yBR$_mȎsciRIZK$ՐH?6+d#>$:@>p_!\b>2zߪԉt ѕ&FeTy"rֈߕ%=XS3 lbwBkBׂdsZM{`rv灯x*F7$q+q8)0Ж=LbHt&ԆN҃]й}\hkL8Bk\s]wZ-HIxC2o1}Le$ހmwO;=q&{\SsBVjU9z=a9uAK$g9Jj v`OuĪ*2/Es V17pK|LQ"̕#k8ױ᣶+-{^ mpxLKs]s h'4w¸ :BTƄR݉P;˺\N0o2:O|9OOP[0Z#orJQ/L(۩,uݞ}d fBȽN-~OSDNRrܤ9 "mg['e<3 ,ȑ{d6v4tI!e"p$s$$=TpK8MLD2!O:( .o#?;?D #Ik4⏖jx/bCp*qF!ʙ(y$Y])Β{OYG뢉Į_DL՜ =Uxaf%̣SF-I㇬64-FhČZѶS}L)?MΊM"CE2p&/hۿxfMb9xtG9>;p"ґܠDK>Yҹ)&/ݮ/VRC (ʄ!~+&VA]<ӇH%8oW1wYu1wཌiBYay¯ȇD&O=ilJPzBsa}6N1_P0 fAe0r3-R!VRL-=`qN#?ۇ;72d-,Lz:-L#""zOUY"(T;\tmřUjDVdW: Pm|h2>KMbYGi`,Sɧh[Ε6i7vAsmNnwm4\u\@7% W2ͨm|D )wnŁűL'gѯt$\d`vu1?%ftIC)6XUA}QkS(ۻm'9]KэQƉ9}L~ î6ݦ@̠5J:l N ,b-$j-$6+z AXV&_1/ Ti+=]BunDi>'_z#o ,I.kXsv 3%ABZP5lHyv8*"3?wE>ķsn?z^pI`M˚]\JȔV@ڝ@oYqZ)_X;GҜfpnTy J |GX Ya=#\"2]+GXſR,6co˔*-D\ ~Aᯥ۱~ &>CVC RQD}{LSD9m& S0“/㓹iUvZ Dr| G!G%O/Iy `q#7vLOje'B/pVCLm%v(?|@Gx20~7SUjUFjKO;K!Xu5q}QN~0xuB?ܱB E]h5%2. uy%k\ Vv<+DP" vsL]i̷;S=Ƈ> u4 (56`Orf?^ے,Gx%$ݑw۵`DId\=@0vpR5P8 Փ;Y9-ah}֭VI) *]\ C 3iY9'Ձ}$,G ʏk2w6O ߭ih_;R W4A:u \?k ᖍcLO#3X]VvW1]^Qn ,BKrM'g\G5{Wj¹xQTEK? H5R0ߌ\gPz'ܣ[ewPOvH,K\Sۚ1(fcmֻVZm`n\9 DTܕB7A4JXMr>'d8"O5)/WSzp5ȟkn1=UQ-D&Ȅy2to{ s0)~RucǾ캫Kkv&HO2i"q H::M;לD3w`PyQߋ %'?;OVS)RԘJŊ>5e|,L28t"mɆFڪ\Տ]I^:B|X ^H;΋pb%8vˌ&E ?vGֺikZ;IsDJ5ʏUY>CSoO?v߲͛5Gclkd\WZgIXao.7>Pn>U{oa]R:g>Gak&FL\l\:'KaN; ji9ct];W)oY5skeOk4?~$ .|B w|:s8ߛ`}Z+D`zP_ ;tfᙦWO℉5>Pbw';:&uʯ1V eCڱ;P?pnpE_飹6^gFVj]7c1J58F6ٱ Fnޫi,ư 5`4-)c݉b 3}.r! /#= #jeeo_Kg͋:bc\ ;.NRɫK%Sݼ(%~фaOѓڗ:z0-{6|hc־VƂV$0ɻ 3 ws70y0S휾]j` -LHmUAHչ(BS^-UE.N{0k8LB"x22+@oRۙQEm-)7RFMc5v`7RێLQ#yM{%쥬Gc'V'N1.3D'lrtM8FZX E `,}FW,%~hC² xӱ u\UQ*4Q(K֕fXxOipxk*ͽOP Atzo[#4b>͓^y; sLloX-n㕝3Cg6Si}MOe]5274r|bȵ1q&Xp4løh 39u<אǜruGQŁNL,WkdctѶKnAUcFKmWsă9քw# E_i!ttj]LpLt{Bdۂ[x63jR"o+H mzÈ?thhh/Ia[ Q\e竘0FcLC32-s"RWwQjv6(JHm0ǔƤVwXubJ8G@jn&թ3EX緮-KduQl :A*2y k3鑏qPȥ`M7ym^ym򶈩OdUU-q. e岗c;h ZPsRСBלBrh.*?ԧVg6#u-*zuKpmϖ}5x׳-MӎeEh5g3N8VП[]Ȕ9jYjgyI}3. dQ[^Xj +̇Vi =Bw4f1LY=yT(J#qyqPx#xq61I6/"[!t է$]R&[kg^)7Ƹ9%~><01 G_ V.KVnՌ 3B>ᱡ<נ67P=Gz5d1#2ab8 t[gؐD ݗ^Ud0zBp ]'Gwuk?ҳ!Ȯ&Z<=86 f[ԃZt:Zս]Ot.t8 ?c80y^4,$K- ]I ?HS[RA=>l!z/TUP<ξs`eKbkp}5~=B[ERdRg)}Kп?E9O}¦V-).ADQPٝ6X03gs;Z&_ScջO@oWA?żwrT_|vIOڇx&oٜfy] gk2=E9G3&v"NxmET֝B$^fBy:U\Rz5I3Yd:?SnT?%ZG!O,nː .oz_Z&0sIN^C_a-5x@K7# GN黲h7&{&ݜzQ4^yDE{\hJk`"a]m+r ɚ"?q[wvpE놲I+K](c^)Emj8L(| ؞Uoo<ҟTgC̷QmHOW0d.*,jQ&a0|Cxct*l><OhKQseG`:S! Dm I_F6Mb?'h> _{𴈾o]JQ~d̢Q!􎌽 .:f5#0.`0?2a]ḁ̈̄~zw*i>~}1Sҳt߱^4Vu;?{6K_7HM!{gw4Gy>M>eGiDwd9)ӑcmAxMP_|"vl7ۋ2,>Xr&N)#Ӳ?<>; ̗KM~%Y-?V5lU&w )S+{)^9"6? zk+\- ]AJ۾\'Y6-iEjW=*W #E(9*{Y2Oz;@zkW .z;[:ܵŖ_6tĖ B,)su;7Q:TSypuWc")Zw#~䁰/I=K_Iٲa|a ywr?emTp:v~X_8pIRCK +Ǔ{THekSA?'ٟ2UR?JMs&s<)p`Iݥ!e٥U$p%۸l|8lj)u2.3 TDz:8FB PlZnT?Ūm( hS|XA),Ɔw/GV-`vOJY@, qpXړS VMzd1BzVN{&n$03bm3Qvc&)ig+ۙ16x/4 o]I^>~ eZ=4_s>"*pX* <8O nmI1@~.t3dDeU$C]u9gSԥU:9FDQJ]?F#N"8凮fa;c[_Uwu 3U{3>g&RTUncSf3$ [!Mb񘝇MaSn26_>19 |ݓ>ON/a%ݹ^s !eWn1xq6|kDzWý6mNzXc8\sOJ/ӵ Vm-~:>~CyC=J:DFA_K9H71v FY2͏.\zJWN={ٝD0UI;06ڙlzcHZ/}ם@_4t3GL4:JgpڡcK+ichaHcw x7Zɴ;en?~=87yl?p&Hj<r-X=~JsO> i],`p#w]C3>YדMeR/3Vta1L)1S1{]# )Kw!捫{o-~ ]lG_ cft(d+L0vyz\͊7^~x`d`WC?9*hF8m< zb.1@JK#KHzi3G"jvGO'IZTQ1lf ^Nmai&LOqjG3E9T $qj`C,d$2aElُeN 0Y41O|aOyDZ߸h2clj.drV&қ0xV EN ¼< q9lb"{=ZFLd%Eb>6vҀV"g/A<¼̂RRٟNJ<ˋk'ԉYز62`먅GY#⊅_8_t˫;ذFE*CM/YuQzI2=9", ޸x9ux3V1QCrW5GU[U6Gt,( ѽH8N Cy'A6b15 [8svuD ".4;yՇS__ Ek) %==<] ;Zp-1[#:pV,XA-E&[fkm\~?rH j*~>9`r;5dA;z4}9mb{!`Ryvl=w˖JXx1a'nmNA:v puKEb'}ӣ/ :(׍V -B7옃dUpC%+vH3JE|q$ gF [()\254ڋD[뛃?:tbk+L!@āz+ûWvcd 'b1XLƘ9?عs s[<x@AuL_95m9)}4=4Y߃MZs9^Pd ~c@C4[ ożZcNA8Έ;Q˸xDR ^>K a%mC޲Nyr< Y,J'ri4/_w-.[{j_D/$8E7u4ˀvо2?kCdZP*_q"4ZӜ NH l")NvuxL>FqjUPS^k4kQ3 g|r!ށux/Br#f`>z7Dzg]O(JC+GRt{{ʈop',^y1N`mpf9p^8#Fa#\8gכK.U /fmG{TÛi5KmUb}uuG]Xv;n;mU_|N FϨ&n@HT^,2-y:J{luu.ʹ:9U?1xU;^d{?h@k>G잭PZ#J:˘ո* '{vSR #ayi>^I2ψ6NEUL_)Uui#,i e/`\740 (ۑHFif~@۳ /!/C`g5{Hn` \vZ{BlTZ2*ILufq>rݐ[[l64Cq -!o++ */_6[D<& 'Ϝ! KK|S0eX=Rn[@ (kv^z#^/&ĭL: |8#NEX+ 5u TC(/m6)wY@"}s]:F&9/f@qwKD@QYoU;^EDU#D&dBy*.{S1-{l½.vveSbE 4Eټ/򨆛I[ XDUF_ךn9%ςbv id;5,DרgVt͒l_ ,&^+q5?I`qvf:ilFƗ*? sdz]vAހr~rثY@U]]rk"|9QxlC.bIѧ=NڝLEޖZȣvHR#>m pz .ڎ:nZZu){5Ky .(v3)mx3۩{cku X(V~'ʋ!=r΍Pق_RɗG6#"`p> Yaj~GNR; e+ lpg Bͦ^Iq*_c.UfVvb`[ Q'T2륿9F1 ľM1x?&x+WURH/VD+~Xګ=2.Y$W">#_t XOdV%:-ULN)sRe(eI9R#󮻭8q|V?&4UoXV7(Bkm+&ZlB~'bZo)1MKB /p}{f[Q:,g4އ/k^Ծ,ݯRW^}Y}J\#U/*)7>$ήml dEaP".zAOHڱ l>PU\hܻXO'.K9Ȇ]ilØ/Dsbaި5pgJV},|fݓ3 [m Wxhxhu?6Wm iw4/,ź礔̗;4.-\j2i;mXgIG Kkm[TM t{Uhoy e-5g=!Ht c"J.n-@h'r+Ȣr XI@R|Ty01b  HR9Z CRs16ȕ5(F+ Vco+sF (*wecD*R6p: j +qOosU Md >oQ؈*~#ʳ!%F*L *aCrFRP2Qu<֮ SO;y [+Fw_NySnm^茶NoU͏лȡ]fmn0|AO(ok϶7/AQ'fֺ7h﫮ycYD_]z]*N1M$:Esw[Dq:}#I3zV-CRG5[W+e32ZtI$g*+]49 kcFTE50sCj,SdǸEPD_% 7K Ub$' oKG_Et)U{k5IP>.@W9t +&w/:dx7Fٚ#meA3gknWVP_bhW(/+(áA=Jy}7Z]ƭ5NМ|^SN-ݬi.R=K)ea΀U300 NgW^QpCsК:}S !58 i:`8^~ݏ.^H[BڑÕ;[tQo,WOy$gV#j4 tnfXmQа)=#_%Rh7=PĩxHfI+2kN8ύFQ |gGIsz&ٷ]#n i(#d2٠`)솓v}){gtRZ2hkϪdtۅܢUYw;B YX rl&$'YiQup>ևT,m~ނ7D 5~U{5U/g|T&5^+3@}kDnsjNN,%<ј+ށn ʝ&C]ܸڅ2F轊4󅾮Zj2#xa.9Sg鶻=;46iTTCz쫯Fs}&452BoXuaX;%Mu%?o +[j4@oYfzUQİk[| cXvGe={&G5|eZrui5uotccOvςIӸ8&e yΣ y.|>>+*)Xw%}`KTirSfNX!b~\>7c`Ed2:>W^;o,&cdM1=.exzGͅ[swAgwEi[ (o;VU}? }/镶\{;,'L~ m2i]TY^.2nub2p|Ձc|}^swdE~oc봄ײx f:KژE uJ>zxlL.x|D uxO^+lؕNS{ l0 Nqc!CP!3͵Uݶ[$yIu?G=iFEΤ5a=kNp&MOgJ#T h&t=8;/_=*-a>qO:b:B:1W]>ӟLUi|#7~RlLy+|9L):)PޖКRSH׉{%$Z8X4A3쟢AAN&SZ" C͂d[$ə23rtϢ֢ǰsEWՐϤmѿYǯ7($(ytv9!5]KlK-%knI@8X]DmqgHcԢڽɕQRqI.L/ *-'9%\"߄ P渽t E25EV_I+)4aԽrc/]DAxxSHs#yd"Cj%l2~QjJG9ew2,l9HsegV>肌Mo *vÉ%ܯ\-(԰|Hȡ| h󜷲._a36A̩O{i-IW]gh ,֙ӌM/Y0k=a~tf*t3X yۚеߘʽBNaP27nebvjf1YA"s<ngeS]k>@fe3-c-r3\5NX!mXXJf`K=ܓLثw"?59Ys;{ѧe>,`2T[#Lsy<ڗ-C`{-s_o| 䰋!O|$hF׉k;D=Us@Z)K{XIՀ0b#[xxfahA#әh1nW] Vp 0\Pĸ֤0(6/`tl\h:3D~ L|$3`8uJM3^7ZA-5yߗ12_cc)@3Xq##[0ff8UƊ2ۇAWpaS3DocȘ_'cLv8& [줏GN8ø<Y} pJ J =~'G)9 ^o^gaDy"Xb ᲒE< 'NsA%HԮu9c3g7mL)řA]Z8O%KKh5@)܎ǧ gܘW|!Cn  ms9 ;xŢhzc}(؄3|\ʎ/Z?ЯIXU[Qg=[VpЮ ^f^ -nwN_5{z8\Y s"CA !+cyL3yxAc`pdۆ Ỗ߫/mFZ̓j,.XhdF-Ԧ!MVbRBQhh,(^_@]L^{_E^T]N]_>Uc{_Cbbqv%(De)+P]RGZڋ N&]>È`^9~_WL=AYeS'xZ&Y`V2_d>mAfW"SYucHi61& Q|klL}5INlGq<n[X\M)Д m ~F((`sRDzl8G;"Zc+[11ʫO)'ȏN lĉvHE䖻U7Ws) p"a-d%&P.|JVi2u?'RyQ y^!*DG6[;Q⧹ܧ>$T25cSx8/5FFE0^ؼ{O?/..i'=ښ|Ƹ "BEgugU$zMuf!,#d)ٛd"Uz<؈x r{zr,C5]fU!IDEd_d4]ŧ@{VOP3iEŋh7nAJRFQ8-nj^ڄN܃ǩEe^0? H f/\&R!3GlɬYFq(*鿢53h4r[Y%Gfh,_-Q\ٯ68*=C5լY.?#ʜ$/? s;+>qRF3pyfu=WqW2T hv>1;Nd(L|+9G<})DxU_%iT?*v(h.|QHolQLݮH3kD)=,"frlQi *&7DGR[`)k*zDa=-_dmP v1 bb:QIHVn/W&ћl kQyO)ȷY+!GIv".)EJSyev sn;\* 3ıd&q632nq 7қjcpZݥmOyzr4ߒ[UxPG {rRYs, aR&=LzBUuLrϸQe'B!Yrx:њHfAX[ ظSDTX=p.d9oWÌs\8n7Y=fd-4n"r}r$/UdÏs~k)exΖv7t$!R p#׭L,`7~2WN QvivLGX+`X? ȍuO&z*4% UD%zlTMJ^/[o߼N8}1n`"9e&U)RF1ٞ'o7_jԠtx/`fs*|[ed0ޓڦ+`tDy=7(a٪en|4A^:6ξsY*ڼZ7ZyjNɸ+5$op<.hH#1O^YmZe&F =R,`GXdVW&(ni51Q`(H>sd$?jVn4*kuex+XtXW萕]BBSAInZ&(=Ru ٘`h2l+m /F \kUպvU*E75喔k;Ďg+l5՝Irl[אK&R"HDi*|l+f.F*V^$2[G7|i=Jϭ. ٥+AnGj8Ԑ&_ڿ]+_wԈwY>$ G4ku= rxA v*Gzڦ)ˆl-mtH=񫼌.3WQߜq῭BEOl8wNhSQ6n;nr;z-,Ie5 Ze 'Ֆ{5̱TmK3*X1WV-:e-a? SQ33T򤪀Pܨ1V-oh)*3T˥6˼DDIѵ{xŜ˖Ni(@8!aMۜ)}5uZ,ci}$᩵q0KO‡i؅&a-mM oUƥ8S+]dnQRʮJ5AX6{/G, F dvL-^4٫f:AiNʇu)WUb*j-}F{gf) gDrG5=3,yľhʱPm  VUN%zt.Nd`A>fu7=z~`nmL`]6C Ͻ]>)H (neiS$NJ7αp^m3t4&n8O( FU5fd֧%ꀴV Hk)&U5N"+.#e 0|Ҽ2Lzՙ }fNݪzpuKrL 9pw|%6?o>3d8?TPp>hc1)u%)$J=rŭ2. ö[DP@ IAzݝ٩^~8a7s?}]ZyZ^e3g&qvޡ?\lSô[MܛB_`3yrBy`&S__K kN&Ohp{}:K~ĠMoL> ݲM;8enNꛯ?'&SJF0ZNŦ狼<<SE`G(58}) F̝GnI S6*]4vf<J3gM'l<˔j\QvU38\Uy!ϰL~FKhtK7DZ;gv6Fk `=Kۧl=֤1QqcfW++uIOIڞtTw:`xiPͶ>(q.> DsWTʄ@/hyx R'd!ΩZýe;S` e=ǩd}|b7FsB/`Qxyx(o?v6濼0UdzM^]9հ8IG ~sfp6:V xrJ^.h;d[L/ K,Tf{:-- qn.A{-y<zq&Q>Ŝ:lSN<G+ˬMl$jq"$s^BCgp[Q: 5MSN55]; +bWg)9Œg!\'Q}ȾV׭!;.߷1 Zglf(ye쟊qi/#mO4rߜQn5͍~m:dj+RT*,ϞS+1[~|豐Jv1J1zi$6ݦ7=eLQ3$4Ln\+$!R_s&FpnIڲG3#a;ږݞ㇟h#ˇzir=&C}z֥~s扞ɡ=y9md3}|ƢTƕ9̎x KT,x*H_澝fzJƑà琔r@!LF4:|,NgLsݧk: 8f b)G[A@v( 4̣O|m|HpTAxnGirp>W(856x vh ,)q#4A8;4fr n[C0Q=:)=T0Sa% Q#/o3Ը|5|"*7Bz`146䥪Xq^|j/S*yG A+j“y|ol4X_Jza]}У8R_}sg,'&!'wHt60fDF8{-V6k WdcfmR$gxcL^wOcEjpe"n[}?{9ɒ,4ZUk;[\`c6.k޷wUi΋46p2L+mc> *K-m};q~sytyaA/rVp=B~ZbY D}5ڄwEo8G:~r +?s;g9K9zK'q^=LmT_ LԾv*=垅Dsi@HC_'d]x>>"Et^D;%9.A\[W~K0.Vbi*fqy>vZ O?7qcFb Dw /0)߽:zY5࣒_̀E[? ow ;Oo! d4G_W4 h:q"G9)Htluh; {wղH﷌jg=$%ċՀ%zT`2QοWj8 ~): ;9.A,hO'pP!$ID9 +G{LżX)꫌l@Rs6€OB=!rZuIu`#jr\h& Ys-*'աg 䪶}DjWXT~dmMr'&lÌ]z\{5_&a(;kaT.K(:Zp- |;cIAn㈈>V<˚댭h}^6lϚ?+i5kA"AMrmux#n23Jȣ6J ~HjbC9;W.X, n1) u2-AdӁe2:#Ŀ|d\ $c~Tq32Pm=Fu5j/F'2.X&EvcĜ/nڋ`IayCΏ{As@caUE:Ϧ䤬'ɸ)$NCJEy! :,w,_>j=a5];59WPD(LE4 C̡?^X=tu ЈUj5h2Z*x4)#ȷx''ao> np rRv)?J ɟ)V3.emEtJA}`3D=JX7Z9)MSh0*y:3WiGad/*U4K"&V-ى;Yȏ*/Օ ŭNz>T[W"uoI$4Scnʔ &.k,Cv:׉r,DP3zS%l~V`q mAmU{L4 $y@f;-Z[*) Kn@$<,DEվѷOU(%2SA!HM7bF%S2a}IBS~/6GW4^&0 Q6; -.'{q%;%wk(eJPvr45`Q$*IVDPb<XG$>'k?&V;+Č`J~./:Q.({.b8k_"Ɵd6dkpe^^ɺ4/V}7-%MI6Z=& +?{>~@,mkDŽD9n=,zCs%ЎQE=]ƆZ$ɐ+eToV.?V&&*RDVw?K)9'UXV|DJ ?A|/Z{o67U|M]~N.D*~.̙Jľ^iYG썇5WcSSʃzob*[SYe1_ɾے뇈woסfgYb>UfԆ"<Ūo'mQLXqEBYCJ18Gln_̋6Ŵ9o`ӸD.DTd-V$Wm>/EFIf׮"0s_ݖε"3sP-+vw{~8MoLbrMhYŻuEm*F.Αy0((.{kҐ:McUZ>gj8T*Ak 3rQm'H"%SqXۣG)3|گ<;y+>݊5|Ui.6]O{ ,jo)4J7?4Z;hq|rZrNJF̅B,.:$x5)\e`}67KCGއ-W!T?#^ Dx .|eF>ɵm+F[ugM2cQwNRqf$VvJg65oKzOyZj^>XJօl2SIBsu's]$8lW'bs-27o3; @d&+dY-|4;tFVu(?a%ZMʕ՜'֣18oR_2uЧĶ0Lv7jVIXU%CmgNEXYe%sζw4Z?$:־[!. [dx䟧z{.'(eN~ 6p4}8c2Rt8gGؔLlD/4}/z󞻹Ϯsprs-+xfFd<9s{Z@@ =)'<#']̈CaV|v7Cz#Ody_n?fRl dpJ]8O?tRڄܗ1"q(Q7SyD?P dVƲ8pq8-ھ\WnɆ:[% =ޘC7'|+?ܗioBr*$FkEIجHt4{j3tS2e7ƴEsk>_*saC7aJiJ=J,ÝxO$ѯ7Dv!g ӺOP3݊tհI6mʷE#Y&ܤ"hZ-DY=WӡFPv#?5[7 B[yIaM*E[ +LB6U POTP׋l~0dGQ'W Ur2PCPhgVkCfWMSfʗ]V=\p8";NTX/"zpɓ1VOeg߃K]u^T#H㵊`N/Wh}Vdl}*LpX)~hmGD6@sE>fǂ]F2x;)ki5+6֦V n mTu&d%_׈~ڣ]idiS6hi}Z-US=ccS\|͓.HmJ:-t_J]:hشo%SAܹ5b~ ͪIa["$IK}9 Fs'>iA  l6x1KV"];Ypbb.s%wF΃)ހ+c_Lnnnwl 6{]pRay4lAGBgNevW5÷QAOdoP68/5$+ԥŠ ;߉gOX6!ֱS2veXR_QyW$}VY}!"9K79f#U}=WZ\!#~YV{L6aA†oM]; >xlnT.̲ GOՐ=+)Eαin倘$lBA`+)E#jatVV5g})o=3x'+^.bFoX_=su"0r6sȢܟA!:uLU.*jfzr2RBƮ7bks.=a!E|HcXO)%ST s/vaXov2. $r".[:Vs-}D$O̤d")ġ`;nJdtB/ka [9o!~Eߔ{K)wUۤwR#bE9Y|%%mGiWeh,=N>!N鴴hn]Gv.5fTPHS^Y&)?t$qXr]$PXmg2k;;wܭQ D<_FݬZyNbt-K K6I]rʥyY:f;b0z2dv<V8ghք6Ҍviz))H]F%cBm|ScHi+d/ |g_LiI*2*_SsYU>,f|10GX~D[~V!@W9H}|-}U,-W26d]aJxqXQDoM/3Ij־>Fg 1ua8Y{<@/W2f)z6K2@7_1춐c?1zF{ RLDŽ^rI R{\ԸT^Ni=.XB=Rn^2K{2ӕ{,0qƓ[gSٍQWRM[-tqK߂ML+8D侮1h'YΊs%cN5ۻ`̮$v_&wwm\nZMD 5f Q̛j~&%+l!k:iYU.Jy@#-,Emm>J{`sWV˵68J ;R/'e r"2$OwxƅpzV˨$X-g({49jB-&-{yۤB _^ص% r/Vv138]mE.UIܳ1_&T1 ^XopI;Z;؍ 5d=g ]KpAt'^@m_8UV1Iη^Td'sc\N~$53}0eo k`bZ ,Q=U3MRY[9}bߍi|M:sc l3+oW2/x+E7=T}Ti_8rᜇ~q5D!zC.2[ʛSÍ[tk0-pˎT^/#-ݩ:)Si+M\@1l ~GܴXc%ALZ濵 UR{nQqj_0瘼rǬح0F# sFDqQ$7dfM5eZݨ)U~t:K#Wr5;vM3: ڶKfnn_A=űUv$6 ^Dș+:1b]7=cvk)'IP ȷ:*\p|-:d x`!P>^@h WZ?}s _cJR7B٬K3gh7;xX<w@? P-ErH841bR0|\n|q|w?)(HU\wUSfx7Cp26E0-K>+Ed`tN0 ^ #tP&HV-̧F~l!?Ar*ϗQLJJcu/Xߏ\lyO*7Vuen:sAoWo^\E>#i΢N~fyHNUyauRWuZqܒVos)H*6yGx'$˝xEwyP]k#cwE2pU(luGΐÀ3c?%Z|ojºi),?*6(ZZHbԠ5S֊aۚkf*ZVJ A2 zo=B4#`w[YYjꦰ|@X+N FiGc& p.".BA!_烩» E"hIPc`p&Ԩa"zdFd܅=qDžCOȈzWB~B"ƈx{tA#*V|^+Ș#l l̅c X/4|Q$p7cWh\yh?CfSYإpNO7&G*OWՂa$fb୕DžU[6UǦbep xI[rXĢUy&K.ZB/Lq,̅NU.:倗~ ]/UKmq s|QOBakk&}pB`(DZ;ÃjDjA|1k7<<$ރaavz rjl͉*Aтsy,jJ-~A_]V XYE&_R\(Ր,4%hDf>Dqjx%:BW&S+C9P;]uں ^U<9!&Ht(5֘kDta ?TLQ2=.63R=zU}h]yF1]6|⼋+!63.[|PHJ )' $(NL݀pM) "fׄsrK(("%1R~l5"Q)"F-  46BbVZB'xY"(H⩹тSS€l>]i,EA5J+i ^"Y.^$N+ߑ't8Y֝Lbdh oׯ\"EAfԼ,V&nyF*[k&#Ћ";.+L#[r$f/f-P#ڈ-Qmy%CM+ɟ1[5~iJMcڅe9uװ K7R+u{#I,6;c>:;sY~"/h;.7\H[->_k{X^j::=A$Yc᮱ h!n+`qMTjJB*˪R }%#eO4U*Z#EƙՄ4&x]nL<*ڠ$EO6B.R Rz̈́j̈́Ϫ K: B$;I,LJm|\)j]xITyDpO|52п&g̯ԋŏsY=Z7Mb'bFB E=ߐ|vdV@᥂- tzTgbo}[2=ğ*j8C:"=ILíWIi: X4aEl6hY, y_T\(&y$ձ=J¼L]TMn7|+ﴞ/ɳtuHͫkʧ+fe%!<*_gv3񎰿vL&咝[r3^SkpsC8DܣE3cU|L5d ՟b6eq*ild1jsl3J\ ]U&[c,v0ތoYqJ鲎y@LߺJӦ ^߆l]4CF1PEJ(-.Oh.eWVW;& > 9Vq]ch*T<NM_DCiZq8No=:^gO8F[کPcH_Wu6֎=3 _Ehu)E#u5 U+G ' kbg)j["WнS\zsU2.."+&?aOMh|hE펆eMj%=2WO%.U }=-C\*TT±.Ƌ a/l aоP-drߎRQARq䭆eA5/u&:.R%e߳~\$O"5.+7؞F's |S}9oM\֐ G+Q`Mzh4#}t}Ʈ VǶULIMSUWѬe"$O*Wg# n,k9yK_bq .k+y/cn0 J2 .Y9v,BPdDsvhK3}^i]dh|:tM\5' WrۃC胸h~D\1ߤ Żg E?+K,pq9 O/5RHz)$+Ҷ6 *I3D*[w9ңBT5gOKMq~uy2U%O* b sa*n_I}Q-3~"e%̜TN1*+EZ@/Sy_Jd*W$D'Dvd1rU\ӱ}HezMhZ seR5K>%RBkB(L!E(xvK9;%vWvMkNUoxWF'kS_6VsY+Wʜ퟉Ag8bXg2*m%. mKEtGǴu5>v\ǘ_qv֝iYvI" yw7n]4\^Sڣw- o >چul`}p7qkf:q8^@ӎn>xJ`nZ)xEK;GZ#u]=xsmeH:A62GrI[Ё&y=qS@SC"~P},3@2?B\ސ=oڋhl+IiA\' ]>xYVڙ(tx O)8i݉o]/$i8' c3jHh]1c4(TW/+9E$4>cz kEq7\9[ia$^;E\զ-cך(Lԗ~VONpo3E츲8Ÿ&gmȹ7{\ NM S7^Or?NvrUdJbE;C?Q}6܏uEo4lr?+pʕ\-" .Ÿ*OCw<"+SeO'_H 3{07qY_Yǜ''H;\JUmIk)Du;?}g1'0TEX 9[~\Z]:SaYQ,ag|*-cӞ M r;םƣp/zP/rga;s`]}s@>H6 |( W| bhK(89Rˍ9xOZ+x*(QVlj ⿃9Eb7JHiBH܁Kb9(-NF}/nLӺ])ʽ>0i[ڸPWj yRlfy&@Bj/O$lzK Wc:̅coksלSV})2t) KewrMݒかhD'F{xh+^31MQv?ַG<#heU݀WWtǷ}?H utN(en+%a_]'.侏9ыNN{^箳p&1 7Yڍ<;+؃oͭ`Xii Q@[1C`N^CO ?[qvf Jqyaš䉚%etA;'/3'//EHp;G*mt^o#j/ #'oJ9}s*שu`ۦAbeKb ש9M!KB?l/Q+㐪maJw]v".fUbkUmn|o','"QxsWdSֈ?[ 1 5i,r[d#o ceso $x-ʝ?rx!n^{xhbf6M̄:/Mӑ|3GV ]UmsEpf{V.9[n!GwenSGxi=w2wU#r:0yb6a K7x!n$lY6a"u8ċQ{)nW~̕~)ɚ%v`kwAc0Wr]g>ƧRǾWٚ\$PEd{Le5h&je_h2M?Y?ͼ w&k7<]}!"JQ{A"YY9Iƚ#R;C;SNx4#7n߼|0$ت.|^U-Hr|$^gٍ*Ꝫ7c=]Z|3W4x RMSC 7^sNW}Omm tP ץIG8e\޼:5?˙ hX=iOV;ЈhYL^K[){E;WHsQh.R#M<,-޵OoCx5i3B=q/s2`/>#n*_+w -eR\.ARkR<:TrA(+SIȌG |žk%%`(Pz&C%i'8 ?JnC2B%PSaI': C<<0o:*E/x| `}5v؎Ǡu m_1I乧Ir:,ܑYyj{N]M)sD&E:d .c| '1gL  ^Şds%I(7a3ƕb |!E8FS["ަ:2WĔ䪠`.ؓ ':X$AX[[B1x £ E](G[qRW4? Ke "0ri&w?; 6takm %YS%id-٢?ECt_$٫'HNЧHΒˢے~?z覕]Ե++$[$EHLIx# M,JdqP7oYzUjJQNVږ'r5e ;+K?5,mNcGWsJ4)ĭmjrЄ31VA] N#ږ%9jrZ1- d{Q7N"uaWA7-5Y1ߏ#4Kwi|K}Tk'.>`,ǧ/brTdA#:?8IܵXJ_ ~rg2Y/$UjvѪvru>R^Т5أtB؜PoQ8`vz=}9a`16Q?:}̿Ib׭VmFĎV'|􉔅Im&r`լ7'٧ T>լwP ƥaajLMd -;&Lր.M)v/7T"=GMT9Z-+SZS_(4`nՑ]@gk@F6[,^JPB^Y)G~$Γ54P,ոGOOijv ev՜yuܓW7.ʺ'_ϗ~뭃`51bM !b۫LB$8b%%,Tw[Tk[yXU%T`ה菀ry=oay U:hM4&ȔtP 3wur!-%aaR"^G c܁al$h?fϧ]2-h|_}޸Z5Q\T~5`  }d:=:7/6&ʟMViW(VStxJ6EN#e7a8*r=ՆʓtW9kJlʋ5!/ђz'BE|EDDɳ(!þ켎ݣa6JkSYŭWm.OgY73#4$魭@(]K=}jEZQNih,/QY%-߾_t?x5eyS;{裞+in@ߒ)MY0]o,mC}h }#աbO/NY9>u-dMF_Tremy&o+\_B/QQCsUX~Lr 'xwm]f/,Tt*9|^64Ct$^֌yJ)TX' Y]#6HW2SJ-$E&GhLf{= %6݂E;|`ZX{Hu'UMTMk7vߪ6A->tE&囦=ˮ٨>S34CdgMW #UnrB5dl3$?'0tĩ?\ϷQosoddLc;ѭ[n&&g?ȌXserʲ]W9)C_Q LK.V5^;-t*1N-/.!͵-&oUNA*!]'Y)|um2a}Hi8üѠA~{;i)Q"j1VWˆMDԶK،'b7$Y7-g89u\pHY|.lre#gWZ!l$:t6" :m[kaG Slv{hPۣ{OWǸQLzuv OXPVyUƙ^WJW՘i҅6yV{)Nz+e_Ʌdc+tZm93-.;~0~BfUbf6Ѻs'붜]asTmCUԲȼG`kÛ{8W< U‡v@\kJ8f";r-)t,}1"cΰӛ;<-K[f"xqY (be}YƎJ5*~~kk๯]cHlv꧂mgCqspd$9qM`eʭUB.rlGx~o ׹5HDg蜡zyٲRcu/YKW;) સݹG c=B_z7x̏Kҕ\yCN/Wxe}󬱃ҫ)%}+WcwQo# 36e!,gF4ά؂Ν\&6yDyeF4ϓwtP-#Zܔ} Q\_/S|m@f7j?b|-VM3>1O%ӵ"4cԠu˾g<k?7-VTwAç-},'WtLc6phd_kk,Px%]&*O=sd!dG|4@D^PH-P^U-ӝgTNa~șl>N_DE ļ:D"ǗхuS-UQv҇ihɌ'f,:F YfoFnӅآlax/qн1Q%t5oFU&cR GQʩ>w o4X1)߶jUsy:QyL=I(}@xz[tH8"Fۮ֢[kgBKLT[~u|6 4lJHb۳x:_x7i3zQQ^lŜ{Ύ|lLZ~cC%\\Q4=OILCL:+g>¼ZD6h9~?Vf>m)D35o$+A> xOlj;.[6(ٓ㨇9+LTP3> G5ؿM~8%lP@$sn]d+ Ȧ6aZЍ9l>:*[9&-|\]0#<8|ˡkU/V?&Qs7 >@S2wszRb WsP.藴r9Րȭfr@_،Nܠ}]øOLL9MZ2wD$r{hVZv^!Gq>fib*clO+ "{P7Q+<X[6mکIo(eYƱmmF:O_uюHPu6p(xYSx檰 M*aCԊ-KX+(ʟnZܳװݴB˹i^|xCye~w*.4ɽ_v]˙ݔ6Sy-tea7814Q;۫tr,!(_mS惘5T f̙ͪu'S_[e Mh5|5tg+D%v(E:ņVlHeE42rh%bΏo ك!`S@@9gjRpԁH^#f%t#k VyYcD~ܲp~RH((<$U~gy2ps@h2"(SʻW>PT8F֞*gC6ҝ@\ ^c8`)meXӱ_)QgTh]^M{[N1JTy)$ dAlN24b>k7mrqv4KcfSŊB\-S0.i)4KDo2^:2v<[{JD{PC"`8@YagrM" ~Ffu [[kbAwg{\Q4Nu7uugTGD pQa\ܢ5+83 XL3SHQHtVqà.Xs}O]ϢZQ񴰞_ѴO- <>L|Rv9|5x\2FWFKjfQu'Iv*V0DBl$0:ʛ.}.U#b϶=A"ڧNߘ ٓӾ]G\@vikRcTaݐqٽ|w![N[l]Vf hg%͉Z4@ yB}xuEtM!h?`wO9F`6ᭃ;_ ={QV}K}Rjz#`~Q) _b)y9/!U By3qz $=X&K Fw)~؁kXmr*dA\:#Tc\\u!{d.`PV!Kǀ׸,LhǑ!athAOi)At=V\N~d+>'صKbM`kaggn+ZezX׋ :s<IӾ)î (#vG7X~KlVQ5DM3 ?=.&UxP6Ҭm6)@#""*[blL&t }.V^k)0u,y'*,Wb7E\Wip"'VeiEAd_ݑ=8@x1.[|ax.Ӱ:X[ukٿUG2ZOI(q -+sq3k_X|$J 9Nr @6sP;0GVF?L1v~Ef9:b B_P6*MىZ;\2 &g<8v+W)/„ݨN/]k#M$C2Յ"= D߃N1P{Ide/rNҔH~1/:f;t$'*tiܖ'B 2~LKu:WK/8gUUuci-K7KF6/( F!(v ^܏fGm#Mԇ4* >9ΕfF;*!ݣ.uT0Bli2a ġ+Fxr}l>͋Wz/SFdF8<I5p>~?X7-״q*b-cm0F(n;4>);̕x.2w*W:lD ѽ0ͥ~~Yus%?^N\:KDR 3L1v9ȨOA^j}U!5μfU1Iv6--W{28(<ˇ Hj11\2dΥ^馲mf|3m EW-)7 yrl$A9QÜuybט9?ԋF)z&/2~ muSlCHV/.ig7YJ 9Ѓ쑻I8}w|;ۭsD l'k٣TSjnjPV.KΓ^ caԚ 8K`o54u4. W^[*(xBLr'G /*d=flFrEUŭيɩ]c!Ҟo ұַ l)cWUzGBZAȒ^}E9SD/zISp#2Ĉ,R?U5\l-lQ.53w ,2gt"M~){ 壜rnM*>֘JP5٥[qῌjˡT=bJhb=P"שɖ.%P% +&*˧sV>Xy[M3Dm2tzm?6׹*%bR+ CK9]UW^ۈ LG`&Gn$ .tسy|4'+z!wʿn_bn` TDWB ,g1bU uށ9rgdu-wIIϔ}﷔O,{tN Y62Z+J_tbW%VYk;+6͍Ee*<+(Ze.C۶-*Fٯߩ>*x T]#˓XJ>Kq2 wk[ 8P«^<ڐ"Hܪ"U\/Ɠ(tqW0{d.=\qŽ8q-vrE 3~Z'^O?+OK؉nPͼx&hy6Vش"9HH܀+F1 o~7t!Y'Fhn0o-1I~CNm[ P^OBM{! S 3jqt;qGLmQ͟ИX4#޲MdƇ\ԧj6Tsx"M#ǡV!Qu^YhvkCZt44&ڍ@z];Q3PǗpeﰋC_Z+ Y$mykTYRw)S bJ$kVW=*n.uVulCuF~on|LcZ )ז* Eː!4Kz"oT{ꚥsYwEi2xE5jHgy)㩨*[b" Z{m sg*M]UJzV^u)_ǽ7emrcms/m^#vSrͯzB3psbz2ʌeA]h+zk5;g{S&qN3t"̦Z#/ȑƨޫ\`lX6s YJp6zS, n锢 Pl)%2z3rRڙnΰ]ܸ݉g/6.qji _bGh&H|l~(A[ClrQ0"ۛ%t^$ھdt_oyD!{N;Ԏ CRpFZDIHx >[*h5HofAkAƙpA ~V&Ubr[dμl"iΞ%}6Uz3Ҭ5ȈЛ"cHw!iqۤysUmyz4/ToK=G8ǿ8\|GC501l.}+vf ۾!a.n,JOrf*ܙ("߼tTK6Y)<ݡ{Is1.t.WfLnL5[S:$FEw.Mz"-&>wܱb|l斮)Ưh٩[F2,^%n^Qv{sur.h"0l^uJ$]_U7lye\ ev~kmR)(s:e=A?A ߜVOҾ:|:vV+4Qk'Ӟ29yLGaZv5w0̋ J7lY|Ze3Tdkյ53Zf,!dGtݫ?0(&v.3-{*D1(ZKϨ"sT|40dI.{xϋ[*u'+6) \ /uQ# 6M\j !-~d4|+{l ֮E-2j!:ǧrԴi_cpaVzkwq2o.NK^~.UWh+PىT*vf])OOH[G>3{ WǀpA\u%kOOWcOu}!|dx%,_S1_:+n6]tx%p܈Om|wlg=]M W)c˪M[zS|)UYA+}^v8)~FƯA15jv 8×9۲VFL~c3oO:qc :bG &nC}u1Eൢ}@s.5ei[oHRXv(B W>ɊT˥פ/SXkjx{v3CBoyZoo>譹^ZzT;UXO\~bN|ĉg=yq! 3/f s~j$mfӌ_~ yƊAE}=vH~UhMdIɡ5TBy0+[d!1$t㎟,aZr4}ma^}q|ls QPv¨6Unp;e37033'v̌eYdvl$efiS̜2t랽C:A`~8mB d'G hK5Ht7[5,M~o@P?$SVcMUtp%G-yI-F/km궬4ږT {[uEҏ^`nY=NYX>g2[}#7Ԟ3pwHpI6 `=m[ sOb5gEVKt tZfnJˠ_tEO>>py0_-y-f\4MKWΐw:_Y"Qn-|ZH? ë^˾Iv'me/@J;3吠>PO3E3%ҊLV$] +]v'5󏃵;*ڡm?@1 !P+rz7 b_hiN"Q^V.I)g_Øަ$y rU,=^=g>t-EvV[Q8wt Z\ay!t,@(mάQXi65S5Ԋ@1=bmb6;?KNqz2byA ?{nl=Cq@i-_.S ޢCGK7MD/8}V;0;f4:Y= wb[)ذ_2QP\9TYYb>ւn@ e/SvRMsA`'lafmc08oY)1uԢÁ6!.H.}=#Ž іȰT <: fr-/CA~M{%nיbyƱ#w{[M-z)Gst+P(kol<\^i2q%5,5DhT ?C0~I}d;Dc83kVG-O Js"`5|^ saWU1 S/zX7'DϚ5Sq.,JŇn`@?)"uulj"Z<{ ~eӐA Ztb(e@y}Sx'Z'˜tF*ǓcJ:*p}f% >V kUX@y$"H#|G݌I,VATX{H&xaXHd6*@zUA9Sic鈧,]z+k|S{]ZRjX2UUlUi*sgJ.ڞ6ŸM_*/w ^ fxK~yz(si:EhYE: WL 5 '5f/FX"b@E~Qolݣ݇Zz C 鯕?Im Lx7v֝v\8X›i_giն7<!cN4{ Y*:[+h=m\kdǫgwS;- mh q+oё-M9,mZ8&IgPUKKRT_չ+}( Z퓅[sD eCz;~~HfNUE0'h8ݻ1zdE'|PX".sGϽIp%+T*2){6{5t)+;4IAZ2،*!ڄm7ykLӅ1T7xW]4/vdJC/aMXv0@s<@BI"|NJ\ʽ!mwPQlHDw֙ۯݵ]Ͱh^:tM|%1T/96_rR5:f~޴IRʲem7#u{7Qm Mc,Ͱ'䊨x$h]z m"ڀOFa0zIj8S r cZ,E÷_פQWD+t۫&KJt%+)Z]toIsK zfVFNI@$C lTvT3SJڼs~VROkeaq4[k:Sr6gVt5qa?JaUΰ-/k9aYT3dC}Մ p8AzP9\GZz`i|}sEFKAξIM=ќ4tN_ex|WwlSlrWY?z>%#vHd+oQaЉo=T)W8WG.5ޏRS4oC LJ?.S'N+>GAC=[Wgڙ*E7l_7zR~]zxTCc+NxdUu*t ߣAzޫOjG:ϏK.1X)dV_\r2Qc4CiH1B^jd5Mhbk'-*l͹.mo[f[EB5͍r7\yg4׌^Nj.jl! &۲7\ihѷ,jҴӨl`gSz}}[^hgBN)JuQe.ej$>\t^nء^ޖyg:Bk6)vsZHS5ϲx1r=mA'~>R 24;5AcL{D4-#Es9ދciK#GVaX.0;[ל8w8#pͅ[S,ڶd~|Bb~ڵtpzՑ!+8[pm^On@lݤ&2^kYEkY;g]^Os>YCM,Y/KwW+͵'7> M_99І(V`2+W!^Y-Č<;#r庪ǂ=uexRX%S)˥6ޖ%12Ns΁Ӣ(n@\+K`]5s.Zv}bx˙24CC FeeF5rG4 #m.SA \ZViߚF0^ݢ~qΛ-Ըm l._>2$+ %kI,iI~E.6R7fQ8ƙ|l Wˉ %V{C%š37t"S4eԈCiCQ\+>K'UwJjX"™D=IIыK!핸/t|K"3ŧQZ t!Vfdtg&634sWr%ۼWi5"4C"Ҧ{ !>eq0.`0 >~' RzYpS&}򷓞6 aJXrgeLms;c랰diEr %j|RtQ}_VɇLkHH9H}p40չ3AZyhUW&弈SBr8IK5,G^F#UMp᫖ E!z-9R8u Y{G412W=\wT>Z\86fTe[uz5@R /"]sePY׋eVޡ6ڒmXC۴I kybWSD?\Lו8s$25?NKa;V}t5z !R.i̲6Tl0f,0'&F:IRcyb|abEͼ.})ͭ A8ψVzDmmG v$=\FjSu1KzyTe'ʂՁK>i?Ko2 O떸~WWrTZ gy.Xo$N ۨ(k\z\I,(9P&?8 ^'şB*G3q~.SD+g/cVθ9;dO}'dG4oZǰ(,g^3s杪c ؜)ks!sIyRBݾn诅bn kj(_y%^dO $_@,qg Pk&#{ `*Q !od-Jw E\n!P:Q# -qUFgǀNXg6揪y nDR4arT=6mՖKw)RlVѧ⇵uVnxs,ml(>s@O%c/mP4 Dyq)<"R:Z))IW6Vjaɂey߀=!W\5;Vc9V͋'bA 9~ "=/4A^PBqV>H!Glw1t*Z}:*%7Vf_=JJ Z/\KD\ɋLEFސ_Y+7͠bSbr$ͼ%OP˾*;ժ.mAmi q%6f^7H+`P=e)Y,YySO}Ƌk h dƌjP-u$j%ܤ_jl6+veSnq96.#%;P3 D= ikѷQg৕ )Ddg|J?t8GٜlPyoBnm=IMB)H)ɠ#IHL'b !G|w:^rZ o*בx;T2Jfc86f2nfٛ/y@ U03Z(qp_=rC8.|FPph(!ӧ#n(i6r{+'*"?ᩒ+%[nszŐN=H: xj@`u~$QYX. ʓn o˛:k %SN%|ͺ#kw%j Jg@#HlWv;N5@|)!ߔQVoRYL=PMTE ̀xC/UU<6Q sD$ª) `(ɐ%" 3.6 !*9 Tsܢ@g hɢT͘&VeԱ=^`DVMDH<.hM1S46Ufcn sg4ƑU $c3,OQ_`qΣK!9͂ >w@h_SN[‚߶5R̿$? 05}+.Nqwk6BϮ+4QU;K3%o; z9ݐ`\<4jo(XmqU }fmFHMD~S0H-I"Jž_{x4xI|4~4 ;k+ '=l(xqj'RZ?+m҄im$6JhOC?+ܹ&On t=-!`UnGmA3eisP/XthtCBsG'NE@w$㔩V兪SRT-eRLȳWm^J]%^3 ֫>BGp[ x0+7j>h^QFr+2;A)Βť&b9 PKR@nV\P?bgeC-1PSKH .Š\;5塒ʃ`C/Fam?|ILLg x|Fj a*,5غyU)o"Gp r<:1vӉQcg~0SbKsxsJb5bC'B>Fe6V>Rybc#z^M{RLfc/U}3; %1Gy@\m&岛׀&4Әl2 [JUU@[wcvE=)XҹZ,{^#[E ? SBܐ)K}pk-ҡJPf!Z%ԹХݨMsR^LD9  >Se#>iQ}GV9n];zրLCW;H/VĦ$LT`#zU&Ai*LEo\שV msMՎQк^P\ɓï4d[}Gmuk?".jڥkZ 6t1٥B8ؐ{$i`=N#8pV 5e>TXNt /%b;0eQ0%n_\`As)fߴL*#OBq:Wp}:CoU :-(ojtk6)YmocǛj0V|_Y$:f,a&"%i]J!0?ˎji3f14KucE=Aqd70*7,eTe9uMwsFD6j֒d̝c5E>)C?=Wȳ>pߨVnkd< póC䩺B`NqHf46 MHyԖ(Rl@9vW~#Z~ ."C:x i/u6MQ#@L@> |a{\y6_]7[ZP{*5Pud3ZO$X <> phZ@-U5{ǹĂUY٨IZ`4]LVG*Eћ &<++@lP,J%"'PsK]V!Ekې7o9D+B`>^h/̥?ƛYDTs3#/f7Z JCc2jFG.b^ٿC_~8oK2`l9$_[0mrS PF/1b v,B'UjH2?) 2;dDbinlgt ګz 3H6 C|ԯ]v.;"TZ|k,HC=.4߉v,j i2nIf_;S!CLwDts5Ko+~fM9Aftm8@L a) "{nH6P΅K=V0I.j%e!|G#GӘ)CqmڣNS5^s#VVtM:VVf8XByclwqxNP4շAW,ۜԉ הX=_Pg}ߖ5ޒ.'o(K7M g2JP"0WMO?S8NlUes#YhU["S - #A_ATy^Mr#t:RHeRk :f*LS b}:ռ}qdl"Huy$> 1}C 3xefQ Mi2N]U bHiDl=CC{pq5Jru(+j}5^=3>$x]c7^Z/Ӭ3@u={bϱ{6}Ӿ uLqZIj]8cޤNگ<4ÃTN5${lZHg%T2ǘhWgkft.& j͆)15}RAGˆ mp|S]܇+o+ eIZ~Mj9 m n\bՋޱ2m:8zuX+"kҟc :+If݂Jbgף[6vcEX7IӉq.1) Owȝi">oh_Tb٪m7=q=d5# PxCloD8ω퇡9;}PܺKw4i*iH4^Ѽ &޻KR+GN&LBwFp'_7 *SW52j!)@;L~0A,I=;9C8;&guғ 5[H;ˍt $&Վ~8Zxή@ _E$[..|s"˷(dgW?kf՗2ĆF9vy-d Xa1#N蓲HQ.Er}J>_7j|0L8J*"j(S$ VK)tٳqܻ@KuI{FKDeR ^_$!Vfi3|,i-&b:+𛜗PHP9D)t*ꗕ8)?* &,) ɰ'9ސuj_`*+UiqT]'(/jn3_HI¶'l跓AS]4jgF6[*zJuݕ}7t?~4zhBt%V)GYψxYxP<sjs:;%!x3*ڬZj^#VMyWWd/([f1߼wuKxl@f6ei'8N6YUBAQռ-loڢJ\71&^OmUҤӜsw;[` T q\^sfZ:NF%P,-lBbO ;.Dy>%t9[ XTb]"q872SC6 "0[x msv;a,k3 ؀v1r.i p~)oֲM͗)3ZC| 萰3M16W*>n;J_)i,OqK IvAYԆOJƻd[Q>+g? '\FW?H%2SM%TK%?.̞zv1)}kdh}ɄhV* #&~ˑ.ҩcL[&3H-SI^n1eͲL\C$ dXJ^>N$TKfe>8uqtM~uY-*z#Gd., PSVH&f}?_=%8U;I(B_|tiNq ^u> %+pB 'şXE'3p[%uDYx `b4A1Vs6sh\SgOˑ3b+ A]Wb%/y:&7ڔ_T7T+(4t #{266MXG{{UvV,9( 9s9ڵcE2`(Ab s~_Ƙckkg&-"əIX2'02s*i&¶ы>X4ydE FqZJ߮A%A'o|uZq?![UQܨ(BKRycZ2;lU)ӌ6Ӱ|vZL U-d澨J,,˺YR3aOaYjX A-sjݒjeUet Oje:`N]>x4KN|\&QbÌ)c/җXrVg JFtM a|5UEEGY A%WkMȪ0*:ϔYX=⧩Dki ;1dqj2pۛ#.n](pͺ*F L$Շ. Rz%HrgGpz(X"(95@PDL<'ϋgѬB 2]R/0\+5:@Lh# sZA:aO\Vl,q{|)UzYfFő1 ĺ\xέF;n -..eIU8 O(ɶE#J|i#Uǘ}hW87~~#dUV 5lXTT/&v-YWv+5kΠpfjiN0BY ?ʥ$\,ʙ<]/{Z:0XKͫ*>:$W0]`ky*Rf #sI\bmgF_`_Дu T'Asѕ=)xdeP5(\~?S:3{-+M Ac@94t$3G4faPC<" 7sRUT#H"_I~$)},ӦHZfK끟@00O4ȶ+eIX96%%ґm Լ䉂Lja;ؑti/zhlԦh%bpHC(o iq>;:" FR*&XkW O 6/+E?)˓iPط\bʻ==_$s[XQ)z%(.*%)f屢el} :#,}(=&UM -+Y$13Pz3_L1 -`[%i"LBfB722`D8?|CnMH} h(f.F yL>j@&Q!A f/\q_n6> DnQs7x/8\A}dJ}ɏ2ra'y5*fFzzx8k׏Ct;/RlDžWWZJ+ac5a;j!gVmt]G5_6W cmm\_nI#X4W<%iwc(ALY~fn 1O, QN2ΐopBkf^;d EV 4Q,6٩c1Ym6p@0X7 |D;s 2y^ˈ/yQFXebN,U7#n 1{)&tLe4V&yP,: `x$QLluېAF&"R+?HH3__Qδ2"ِ )BD RI^$RM.y&j`* 69=\Bp\P-mMp8h@8)jɶ魄o%yEV._Y6qVTID/jSR)֦2>djz@_,=(БҌi\( kC$4h{3¤[b3 /qSVOC Q0( _(d5V) xM &M(K c dQ*.x)( f)\>WjN@Ś%]6^Udx|oGV$&YYuo %Ш]~Tb*)Y2,Ƥ [P&ߥDIxʚV;!sJ-׬Bl8Z };&,.i9K Ց59[өb=E~hRe2%/S咣D!SE}+JW-Qt27+Y/ܷ#:;eXF#-?+b a{t¸x$#ш_׸-Z=|% iBT&'$nOQglcmgj8Wb8]6cn.]f /g#(7a9$F'7{_DpnB+jͩ\2ڀ6[{PL4ˀ3@,V+x':r͛ QX媄3"BD-dt#;yyiN202V)* fy 䇫:'M,DEy^R,] ]$JG#ҪqHʼ\[}D~X@_{Ʊ9B~Cr^Hd`"~5ΏhH9`s-MFnʚK91@?9zG*CO;Ro}% 6?lNHxk!o([nL2~iS.J+}bAY|ܸ&@wٍGU: _VF V#RId5 xh]j18_E<)Sn+=4dMNW]M~ =ˬSn딙R[oW)+3TYtbr~e̬9WeJk2:6b,l۸f// >*$:Q0$la^xn4n!}9zGi3Pa6e5+YdsE!p5u ]m!LX*OFѐdoL/AĮp?ϝu fD|2 03 ]w>*OVҷ$R<%7?ø| >螎/~x+ Z`'|,ޜ 𥼡(| / ;&<ꛁULv\g^j= }0GwچEDyѝzIo0-N|}hY: SЙY#STE-ML$H,?R@ }?hL$u7Dng#$I GR懴CQ R~׳Ea* ^-vb>3 {c "솳a_l FOnb$CzYH4nF6]&+7F@TPr,hⰳtUQbˇ(& FrC=Jqϖ{ǩee"zd1~Y焬Q=>M6svTZmU\0so6h;I6LI0̒YVBW/벵ʈa]&=gLvjh TEˮ8D|[Bi5;F)f%TϤm.Nt+n:+KM*o}$!UyIk2.vBͨ{;ބUOD+vYe+nU`|XmD_VՑ(QE! V]Iw4?\T}Kê>*S]4n vj4ϩNF^/c8e(|5䢵۟RQVR 䘊[tgF&N=,#D5uKo՝z? T~P$"xgCZ'^ `]ș8P.i"Pʼn-V*%=*. 3) ;>USO#׉ [_v7d'Y~V zf5A ]$qN]eQWy^nrAŊ[ҁ59U3OU_$x,VvW'&s6UY*&MRfڋv|XI( .E,I͞u(eѭ e5ٔTȸW şgܤ_T<&xS9rw:߷ulǃF㪣PGۊ6ق4z~2Y0#i6-avT8lV,PlߐW[u=;5.|,ȿp/R{*) | 5& 6T Yr5I_w!Q|!6P_2)Ȥ2*tZ粭`cM,ő^NRn3,AHI\5HX _Y$+ T|NURRtTfmm^'r lr `+ XvU7C=5; AGcmuDۺSPA+(:cF}^0A[ifa]rXh٤3rcD3"pN'Ggmt.ehmD5OK W+\/JXg~g'oв*-Q;HM*ԣ<V6~{a,6/KY^3f,B473;Va%Kne?9Gf,XOXFA0ry=!<7Ť5 Hv=;$K.tT`m2*A*|®Irh50Y; E-NFʄR:bAAd QW6OZօD|3y[QH1>E5fL@Rr'!# }fhAx9k ؎_hN%AÙż1*)qh._(R".o+ ?,Rt^V)vXğ,Y9^EW N*uoA`͉qj~* oyp+Rb~e3 ko~3+kmeNP6N@r@`,"^s E|^,m75Ewy|rmfc푈.~E+6:SfͷbT &xlEh傂;WBO|AcɌ$sҢu~ `K ~@ң>C|S.Kh hP8>gdTey|Br#qUoɚ_z=dV4\m6[ k%K$3 Ȯer䦕"eh}$R2ck{v]>tQΒ=l8KP& ɞ`fj2GK/%!L~'pya|;魢{ flW1Ò͵`bGZ:3g0S,;/n/\HHDa:287,GrN(/ I>$&XBIILHC{AHЕ/l凜2=g'fyn9gUȇĨcdr\> ~ޗ%I܂ʋydoc\9!ZMNDs9bR-^k4`ʅ̠xjG,DBwʹ|)Q~h "zr;-DsYē)ůS%bfAs) p'$YE4)&L/BM2&䑚VG.%ς=`v$"C rDǙ(4'= ۘ-)qh6&(H)ǘnXE;4as6lr2|MuG9ekRu%:T3)]iB=Hs,f/yqIoyvu7!FH*LY=?aʭ)vK]%{5:_ñyPRMed+_Y{;&%o_)å)%0\WBQUX`gEEB9W縟YNv(FZnH}EJ}i8I<_VAN_grt`H'T郥ϴGv$ze%5e$'UKPK s'ғ 6̂O%7qon=dZĚoDP*+ʂ)LUiB_qc~1'iDd/8YG6h=5 8^?GZ:OdaTUESIQJ3.…P 7"Bpٮ^@2X!9{d X½#|Cۂ~TBQ['S2n_Ջd`8Mwf-wbs]Wk2j/$IbXr/~x5ʖ]r %0;TSқZS``L/KC҆`He-2B?ܠIL}Pz3qS\cLƪ ER[o"-d g މϸ)~M٭|ro<3|P/J_>Hډ'Iת~<]0WJWP^J m-hL|(bd7)C|f_IW5(!0g=FԆe!XZn\qk&(F~_Vѱ8G'7 !p"3^|k?C )!wYLФ}l;"l(6t2rɞLA;Wyi"Q.Di\:mXd &$yBSlKfisBV:ⅩۘM1G[('Cp{X n W)29-Md^d惒ґNunU/='fgn ^>z E. vY&2{F+QEo,>Q/M(Ŏ:1rxq -)kĭ65"KE ,Lw ‹'sKB&.ڒ6At<5xk%{KW "c(H4^t6{HiQ) A* aUʤK@noD-xK`-9N\mON*1EfGq[&A^fqI9gſ>E5Df)3hzZtA>Vj+gQjq d]Db@;Fyb)aeyOTN /:K9d?{mG@kP+WSdj|sfԔd-gTHZD8Sg GP(El~P0K=͖[<`-(4hlkwWKĥs,IJ,KK ŐGY,[H_ieیZ"ć)x.g|i|gBgBcD &n$o0fЭ&JbD^q8$խIlVZ~nA/`5*t7@2S~\:xXJ nKe|MݧШh-yrV)5>>+<7IGK Ⳃ+8$3 < +\ŘV;v1ǚYvc}o  EōV%ćvRB&H%> y<4_/>ň :[1w:VI)Vŗ&8|q*ENR& H sbJm,1Ǘ-ij&@F#7BSrBZt11l뷑Uk=^q-Djm'!MJFP> .z#.ڎw<$yuIxn|_9s5ݛħ9-{`߭S&C>v^Q!+8Y3RW2]kPzA)trdVRWx͊PkP*c2*1O?+-bdzfBH彔y-1Hʡ唟e$?6BW:kE|kJk?WI Odهe;SOʆ2{cfDCC>PO-op=Ye\@w Rt1$P/gtOiOowvZ뤷K}aם:>s-DD^i$y 3 $Mm-W:$)އnz+Uu>Lݢ Z\n$vlngqA#EҩD";07H#gZxsţ쭮@W:ubYL6AJ2UVcݥ0xkrw0t3[$8y{WkG!h Y\F-&C ږ!aCbtĄX^9K | ފ~%+%RߥE{T"wsGiۏ #QJMKqlAUIX~ 5of {x @K.{զIc`M-eQdr-u5iN1UzM;"r:oohO 3z-— ,fp6}ZVI*l֞C&&n );SscE1Y ?@~HQ^o"~ >q}Cp'嘗+|RK7m\,_jz2gz8f鮞UmR`9,.Sl4;:S.6EL{dM =Tw(% 0vNm8,љ:L(Lިu^i@Bń!H|IݹyOcs`SZѓ|KX;. +6&]/VF)Be @7 I;X pe&dHķ].)NŒ[0I:CO>Z!n#| MxWQeb_(\sOo;Sl}$YJed͆꾀ilN#&KWW`opl{Lv_2V(]kDg uRv|*rgbLY#l_7E=\B ~(n+@0_#OL bSUr<9&WE氹rIpw<׌wA*#7wsl$99=~Bfi.tw`VeIf}հU{rؙ$'~p:F6MafPYH4 !m]g<1EՔEV]3K9* Rǘ&l.R.,^'=U"o9J@~C7lyWUWS98!V1gDow/qiS4|I1;vPm*j?I]Gr]J\1J5LCO3`7>|耸9E"K^ ZK*svbteU&M3ЕqTtɾ'@21\Y*toV{&@}K.=/1SHjBL+ $ztJ?1GK!G9ނEf#t.!64.52ׁﵹV]}!bIffHB@]wx'ԑ_(Ytz2,l tj54c$5%K#DHkc@Hp)s* s]HtmZQ3| S0 ^z讁۲HC~2C LH!t3J.7cʱ*h V{a{*)\ &=+M§x|6.2<Ρ8! \eF'6yD=;/My#L"KW&{Qs]N+.8lRbYW~Co?}Jҫ*f;xUls^!2T۹ 55_ymS-QO2*xV ՘"yɶrM e/X%Q`a<(WAhfb!'`ھkJN㖡|Os VΊaEƒnG-;ɀtRS5+USW$Ѭ,M![7y( u#WKJKq <4KD75I8eDZfK8?mcBEVQw|zd;O d׸tƏ.c%Zr>M9nUtb /6mrYȭ:xye?iZFlʆ no>f*HȋuAz65WS0kBU7A0Jj]}Y*^3a0r|KP.&*Ldp﵊/%n[|6Q8 i1ժ7[Tb'dep̈JNiś䉐$|{oeԓ7CjsinjRpF1Of"O.Ɵȶ/~WÂ46KQ)Y:v8wE]BƪS~Xbfv sd"賎;vZuʵ2(~"p]y]yd#Q6}c ~V舴2`p<\6/qz7v?q30z>Vm- _B4+II|<8igѮeNcddo͈9ih܏h8s%aaנ.Oc tDӐB{tj-B`a]H=cgD⺺?q@d=櫏2<!Dld6</ZDnj.w5q@L_5AN &o0K.IM'L??M4yiOY3w -70426153wptr^? 0(8$4,<"2*:&6.>!1)9%5-=#3+;'7/@,*.!)Td9\_ %A0b\T5eU5u˖oXjoظiƭ۶عk8u89t_x׮߸y#?xϞxƾk|oM8idSMZ9sV?̙UckjEV.Za_WCJW@(*)Иl@`L*]Vr77n۱s}[۴EUQkT-S[PmR>~sm/_i+~>|˗_ikϟ0~fڟ/k.*Re+iΑ6msWZ/#C秚oNSW__Υÿ/΋w^uS{S{}?CkњWmŻ,i^zVmZv {;d_(6S<r|o!h>W>HD۳{P;ie_=˿{ xuT`d ||{qMO_Z)qkW}jox{ႦǃN?N>wHyVd/\yϝG{s752sҙ)^=rzxq@{{88Uˡ=؝]?{9/%.8>xv(>v_7| zClK?HC[6Kg&pF勓+F.%np)isW{KovBwwwo?Ϗ39eoRUϥ]ŴEg{ /w^o#tH`u?XGXgw-oiN'C7o8{;bŌ3%ǺOO]8/zc^޽oZ]1;3t'Q^&G.G.<n8~+zW쎮ңC- 뎲fݬ=̾O+hﱮGG/GN< ]{;~gǕSzц6Y}znb1~ƕ/ŒtGy}M~~*"]ҡxߓw\/ؿRqs}.*>Y~b#pA?|pLvhC_#aK]r~tCC2f5FRkn\Ok¯—32ہKٝ9]y)F>=mv)c[&hV>_^(n^fn6ĝ[Iy7rncHob\xukS>]c~-Q%[Ǣ "7e:@;6ױl`܏D2X:t7c|xsxSJ6<vw78嚝 /.!zxZ4Q~找 j־/n|6Dy2kKsÒ'3G+mڽNӆʧ 6ƛעqh%h~m?ʫ=R.RܸJi>w}Aٞ~ʾ^U]GԏVZBA5/~?ҙ|)}<ٓs%olp9fS=%:ʮni8$zPߍ?X]ub|CxkJl,Lh򑫹.9t`YƑ!Pq~M}[{VG.W9l,֙З.yy"~p)K}u$yY{/w 3vj9Ͽ0F]/NM/xw1@x[ri/)G3V ?HpF־%̣mC9g7c_snT߬<o y0{ue}ܤM̼iNO&Ilǎ{wDMh ^@{l ؔm;g\=Í~:gI?/ܬ3\j3qꞗiM+Qgq]59m)؎FlOh=߿jR!"KR;2*0E{\%ʧ G4&nV㖐fv&.BJ$.H?5mZX L)1Gur3u9 zezՁzM^(h5nuo1osky^"s؅ o5a+6< 3jijԘa +dPҧQJѬ֪rҩ!t:v9v ~[&zQCo>\-hY)x29%0=pR.pTՋm5Klt>rOjKwZ0ʺIS""((NsF\͘dY<Dz)[x:m$֯?0~'%a>(m<,m(Cyq3өIS r텃>[yN^2'Ufɏ2[mƚm 5\`fDtllTllLTLlTqy]E0_YvfAZYJ'.q2w˒ۄ~БvL!NPffCg!]<uBu.W}BqA6~˄3zgEIu;]gߑUFwL03RЮAJl52u'5ڤG-  13zӀeqi'6Ŷ=ξ?iTL$V$NR'sSK< 9T1Ug\UJ#@\z  ŵӪ lkrZllj#^՞c_!%*{Ez*X,uh=v K3X#VF\v2:J]_}o]q\8 LVRzUިV2ZiQ1XN+{u,b"ꦴҹ#F̂~ nvem|EKpE7޺ϻީߧϷ1׷1@< ,iByry͙>e)|ǒnA%;z Y>3nRiMxi_i y&.&J'9@޵π%teJ=[蔑\t[/SϟOF}ðfbbJ:6Dg92|O+VZ$GyMK>ʟSMșNbF hꔓt;;qNN c?=䈞~^"ys^{ O[RrTd x ©G¾GmT6GT{7?/uJlSs5&dZ.wB! ,!U6fՀNaŀ{ln[*rrη~mZ!X_P’T%~M,=':-0)i3!OWaǔf6y&yƣc˽?uw>测˟f0 q^Uep< ,$feRPm Rt4u>.[w:>;rJxm;6l)揄WDBt$""Q(rl|c_m8%ФݻNOy 6=u4 y?!cj5EyM@ʙO ϐ"td!IҴ if!Ik16Y+!k,ѫbٯchǘɍPiØk~C't4 L[KeD3\f}Sn!N1MN)MM.̦!nR~cTJ3 ݅$䐮j6c<,`+2f=0̙ ,"&]'ѭΩ.̖nofK/tHGi!9dME⶗knj(O[B3^6];<>>CbPm~y9| /吭:(1p33xBNZi87tfǿy-c-B,wH;1d!UV rT"'0|vfa ˄\}BsLWH_S)JPh=e@ZO1CC"t2p7 occi9Tbyo$?'q} j_1B:r  luU25$0j:K9Iy4bѵȼu 2CiC ~o,*~6q`]Jӈ1VH`?-0f995vL퐉d偡-"]C2Jj\0זrVgsI9Q~)aÉai (CO@.?SMbi[Uf@Z2[jlH5912=}"FB#F"FG"Q6w ],t-PrR8`kX?-v|R4׆ 0M̭)×pN\ b`y1NOJ L9@|U^WbR Va2ogjN/դ n}>aQϬrrưo@A6C6]VXUi9tVjMffiv`~bu jQU-k8x܇\򃇜 3IRfqߐw ONꀣUڨR3xجiR~B*\VOk"t~}ze]5N& zN:ZBW\q@{b7qeIޙ镸>0-,PҰzKֱh]7o:Iנ*q)6|ﯶwTTU;GVvn{(X%nZ-XSK_TVJ Pzw.CfM.׺ϨԪs]Kw`WFSi__%V'en˻d)P#f<"nDa=ƲQ`ĞfCf0/ ?<vb+k7 i0,,F9`E*8/KF]˦[9 %ɸj>c:C!0 ǭ\pL೹΋vϟn}^1iyԮA8=?nA<|N2xV:`F.YZ1EwZ%E+:Z_t僇;͇ Oݻybi>c=~[m4c&D1Ehx"4d"4##1QE ֱبo4-HtᎹ][{->7 !|0Ȫ(PYBȼ(JkJcq]G'*v|c\ (pY 5=,05]G!'ŽܶBEv[X@?1t KC&ĨAani&2nhٕ'/Zp,#,ҊiE 8VтMqє]icys%G:DuEZ^Ѻ@+З^ p&^x_`SRhة@ ZhmܻR+&e cM-b٦="h{Ǖ. *ͪT8WTyT+ /Xq HS,AP G g7dX t["NG3jF{] [= 뽊+H5\!!!9)etm 5p:x=meXŬ%ڦ-E8ӧO>BxmSr]3Ս]WGdUxs}ul6:h@i6=K.kktmwjo,#4 coT$q1ȒS\gjXFnL3UU"6A!c0֝]Z_W%6x1>f/Na5/E*,-|]C|dWfc[jo#}mT?Fk&"ݏyd ]!E\r䀉@gA=gXm8x,[y<|Z[&Q- fQ:;s;RIyCW!MLh9 g:'%&ıRlxOMj#1,͵UJnM LwGһGI!]Lre Tjnh[/UMיzU[T3r 9)5I10ހޠ`Zwp@ɿB2 L1A`(HՔwյJ U-4XN{6[$Й ldn~>(jOxNo(!*d KQbPUaGQx$ZYf#35%?4j>qXУfBm0/,w9ɭ8nLuynl9*R|iȁ!yyfFE>5)Uٮu9 BMQ.CWI}#ƪ݀m7o klKuGR~ҐC& Õ^+{gK@J㪚YEIՊxAf{+ݶUJ M*eYtHEW e.oVJ]Yj0:&|{^RiM^|Cٺ`]=z`̼Z\LF X[r-Чw@X`J`@! 9 J]urdϜ୦5qيm>gC+B+ő(TiauvHm:h1±Mla >o"'7D~eͫ|bʜi3'rЇr>r.)I, aa405Cп Fc\@QڍovJE^js_Nz<2 ~y n}V{ǾTm߾Zx((F1$1 {&bOp]`܃CdufgUf44g4gvGU~h_^9Ytx2부3~C]5Z }(e0̲bڒJڒz60\up~y{;΅olt}#nMew{w;-~7MAac1oǒduҺ"U}5Gfwyj7񗒃 'hpT\wᲬ3\Uu}SiwpJ!jx_(P%^d2ygmegm#6O»<?K?K_ ^ 8'j %6+M#"wd\RBR"2#~A,$ R j@v<2$=sڲyb隼n⓱fjjj`dfTd-dYeM2Gmğ:GyyO{2PRB!D (A;6#>K)c8ݏQG9rVU"#*&{ں.{̶1kȮH@Zg@. TR"Pj a(|m ĞfI|d88 Mh¢?2-/ZTѦkh99 ~!!9 B Ġ$e(w 0pvH\|VLVL+&TƊ;o[7m];p1B]QCDIHCŕG¿}"Q"PnC *I4v zFKӅf srWMdCcZY[+XKLMNM"&98raM,(C-Ȗ^G XWwxkh6n[GTgا&:#=R+c)q jC_AC(>® pjD:D:D:܀)CsFIJlh.ؘ /SXN¸beHo_@xo`Z39D/hc9|Q7CuK/P)RX/U[Vjײi+7.4+di94'<޽j o ,h< }t's9G)WEQ%F|Q[bSUEPYZf,L`Rcs ҝ=b)-vq1-jC\~!*%(t+q.KnݍrezUNuAy.UU(ZnXdoM/ure4XgE5Xeg9uv)ZxvQ(TX,P/nso(\hW6>"'3&iP,tm L72ˤp-\MCT-6dVW+l+D!!Wܳ" eO)oVPW2g djt{ԛ᫱R*bquXqm:ר[^^l)A羄[?S6Wj/ӽ? NIXT[RQ*S5yJHP5PCC.ͼ(߰Ӛ apjX GC"rȺ}ɍJۅcIjݚ(wUQM]T!+*GT,&0نctQ\1\1 ]\m4"ڔx"o.JY-E*$NМ΄q΄MΤko t)&Gx=zÂ'W}4{]W{tW?b3i]In뒾h]1UHԙVKњI՜6EؤhNh$k͆%i&$H/Gۥ>k?v쩿6_G.QX6 !n8>|$h,(>׋S7UŪ-8`1@aoO}VُvoT׳@@4TiWjS#@ ʇTWCTVCWt!J-J]P{GxVKlK bP2"uD}V{lwt o {ny)?")>Vx#{-[5(8Kw:z=7 u|T=T`G?,zUD9Akq{ĴYW$Gox pG3] IZ ucр3'>7軆=RHGc491[Z1[ ѫKFѳQQި^ 9x {wGX((E99؃oǘK ԌLԢ#7㖌cgb',:c[ }>'r ޻ Y $-<-);Xǰ- ܤ ݺƄY =9ݛ($!( E9H0ICgQKمnn%D餤S&?4M3mJhKoݙcӑfۑ܄oOy/|rsBP!)TQd!ZV}ŽmK̊OҒAhABڼQvڜqAiU$%eȺ=Ƕ= ߖ`ߖVcߚ:Ձ|s ]: ~wPDKI@2=;lWqKYKcf̌lyƐekzmkz :J̲#O7r}lP$*(@ֳx-h}%5e1|#qȊocmE.5d75e86e;5e#9 W 'I@~f;Ep=Qj9ڄ0bEu tsh il2|Z] @h 4K=qՁ!e ҂(, (]|>AP}`K\+1^aWf:%ܼBjTo_q"$ ߄ti~VQWXh,dX&YF[ 5\W:'3.lVk +ǽHa::psEC >MIt+O]f0ԙ;wՇ;Ft_>-pg=*)U$b;XU^:t. 1w~Tk@ɞ!E Ą8bNQWIQ4(ʫ(ҫ0ҫ:wC_ 9f nT"ZRSźJCl\cǺLKri2>㔒JK#DyyGqC3A>@Rnw7ȻQ:^: ?C K^V?_)3y!KWrOS? +-Y١]Фn]Xa5!s,ҝֹֹlSgInHq^J1#mWUͪb[Ur^ ˨?s$~X~EQ'ԍHkһT-SZ5]#uj *SlJsLmn,}nS4W+50kCrH5~r^賉޿N }<'q|JZ5.IV4W%t=;Zt͚ 3-st\rZZmyYu͙MٯBO>' x?{\)L׍Բ"cEyaڼJ´IiL0b>I4OUOHU`F1$DeD!y9msy|/?ۺru_%nH&?_6YvtZ񲘗 ԛWPĪƩ"wPrVsWؔP$n`2D ԦCr:e3XO{;?);~.\2WQ+\k3Y*vwev%w%vw ğ;=}Z xx7pd8U8~ xmw S`0p]G nXM%A\"XQNJ2VԱB#sA0-<<5oCy3 0 ~ 'OO[7ᴀ6& aK%UU?`x5Q"{ 7Hk܁:B5S4ÓÓ '>%Y7?.h?o(dᴠ$&" ą2zs p) wd]²@L&H9Z'π} lfblfFVuU{CEy?$`x{גI*ݤMLךײqN8c0*t>-VZXݺv}CM~Tc~N:PˇY&@sPﳯTFiAo4e85i8Jg; lo^\P.FQ{e=Բcжq?PuW")RLʞbe_wGF7vy^gpgx< 9!sepEYݥYI5+ bpsgJʌjz#~ʔ}ʘ(et̯tU9#[@~uQ'?U T PM z=V/ \ר \ X 230 2  8 ܉ i m|%쑃@"$- *O G5+qA;tN'$|F7>|Z/3|ʀ,t¨5td ;n9d5QcY{5O@zQq=0E`&Eln}ʑ2i:f9l5d5h5`RgcjY닪.pE鷓@zBx/CmދVي`B | g<-ǝ}Bz]f qmq؂f&\O\mw\1;m_`j9']= !V&$&(I<(Dk̅OYy⽺CZp^1  QI5VIUֹI8nRMKb 3cߙrHuH; QAA̽J")مDmTp(ֶƳ)=ONڄ&SvTC[jS[j"ЖO|gA&^~.s{#SI`%#18lmk v#yp^,< 93HMqQ]IMx&j[SvKbOw}{v~ Osd?UriPA雕d:1|baᎉY~dc~V,vbF㑮wu kWR 2m\L[ğ4r[XfƙnY 4}jn~N()81$ՀrF1,~\!mYs?=beeuԭB]e.%8Yq.]/%K/S͡kVSs[iC♿3ZQ| VĕkT4,|/%ܭѡ;7jy醘TTY$jV9%iT&i$czbJ㵊^P>Eyh&{Xu/xNS?wYYW&$DGeM*=Q*}aP偾PWzlys OyϿWr$n/HIzH9L`'\u'1~*FJSD?0l\>YqGqjGq|* 9$~7Vj.Oo_ 'օ Kz cY<=wuuvpr !$:9r^ $|3|-yv>)Ë'SpsRpKnhcC> }ak=I[xjxx=3VhFp'e-JƩ<<%o44S:6N?}g egx .ey 7eᎾ:/TDLDAT̈́@LȔ,My{i||^I/@k)A=o'ow _矜p&z ĕࢬ \Qp#  Z uռ&7Z&(r6O[<׷ Gi}8yI ~JY!1 ^R|p[e2w@P6uPW@aJ*xx zyx2xxog >J>QU]~" ?_ӷow{ wn]{A_ ʯNѾ[Z`{ E@륩 k GzقHci:Vh!y.;{8{<{6k`*O8:΃1o ,訨!țcAbD<ځp "DVA]1 IUi%Yܬn9~w뙣wB`&) Jj(V3eS,ڀ=9h#8X;dH5J?R[S}_RjNh/ؽ o`& XKJ h聆q ゾt(F8L$KeNeJ:>tVqXWwXV`?5c?3o_wUt03E,,?ߺ^BpJ`=3X+:9>%9ƺl˥<;o):o*V6OTFV'洧'tz_X: }`}48ݺ.;NUT䙮ͶӖ놢c(ud5e۪J#rׇsfg]z ڌf_X}W0S0> <nQ\dU0چ[&֏ulW]VTɞKaj sLYMv۴Π۸޴{ ib׫k`ͧ`tok@=PVt]6X6ur"> "Mjxk{Guzz~ibɔWZI W8E? N3/p<"+˭yjh.9,l'L]G <|"ȽI*۠iXE0$L'UqJŘ_O>?S߀?_!a؍PYAJuY3jO1w!uZcMLLfM5#eV#l@&n8U-rDv (+ѲwE*̇Mk23&[lIJrlbH)µ`XքYqC!LPP(?JO_ I?'va=ARt Fb4LOĤhe_G#]I똈|&)ȳ鈠##2#S#^?+{CzPHH В C {)b+vvT,|3\gp3{y֎j۠튱HPl&k=oq2obZެb.gr"D N.̩(lnn>W¿ZsQsO@Ԛ֐ j[@GԇV{'NwW=F* d%N'Ǥ4 Q!.vO}mj_U*kD}H^EjF_d\]^z^Nʭ.'-kC CvfG崥 kr+ʛ⚛J7_l*KĿ5oYiDu#of.2m#$uTW&k_HYp\gaDVc62-8)9?57-;-+i[fhkFXkf⅖ċM>DlY2skLu4oiMͶ'{"w;anc{ 6v Z2j -i)9)Im i;SG:SFےZĠ"Q YRkRu4cnl7 s!to hi I//(-פķfwEgDf6vGdue <q>' voYRZev5zM<ߋ[}+Ö2lܙ==^~UAuaQՂؖ~E wi ز $ ߺtVN6Z['uV_8f!yQg~'| ӥ}W'?958/!2&ɿ2[SYS]=S=-m-3CP" }ީ>ENh _=3'ZG87s &wF45s[-U֮&VہFVzNӥ y)K,6Ew-xrXuޭ1 Ֆ3>tFEqg#LvA}`'#d_/[ћYWYYֿmׅ *=;V H\C2_n5v&u ShgZ;@.>K< H8?J {y(q=/cL/e 0ۋ]+t9|0!}0s⼷pgq@'}~t b| YdZ~ }}g풯ŷ~t]ðBرy^ zf6J/dmFA?l~P??MI,9_VŁ \Stj 1ކe^ч?q Ɔ0!lU5 ,d7$TT@M 4,Ep]2?8 %X2(F@w5OW}cBSZ㢁ą=v ]D `Z86/K %lbہ: k,@h &$cdp"k+Y`DRr8a;aX#r%2ap<\m]d %(rDD ͵ y+l-ԀoP7 %2W?2|°V2>`B‚%\X Vw[Qʘ!H(끌6(kڣ:*`Z `%-Yג0mZN⛁$<8i3ڷOǃ# 3L29`\Cs{9`v f#l0,`B`?1{VfE58h@4gT6,<<]/ L^`f^`>8s]8'سXIwiIw/ظhbrz^&zϜ3|G[Xy̫`V`u{^?^3WI$u=;@Bg.j2B @e>x` `./~O~  Y;>_/?P^yOR'&h^]ޡFs. E]U|T4,G0\чP.~Kgm}xw~3#w;Ay2ͽ|{{*`ngr%_W  ;`1hf8C, Dh2[dz~NO&o|1|Np6wD50PSPti hz=Nb0Q)!S!o_S;_9 z| h~:g\'nO] ȚeO^\qbR[ HIudA`&Y~ A_w[ 3,%->sf3ZqSzmcGЇ̡qד!ܮurMed({2כȓ^ Q ^ \Qⴥ D tffbӡL+_o3vp#{;ݚ#oDtq4+8o"y>2f!x!&kCL+ ;÷ɎVb#îzfY{U{;=u6׭>Gy/}{?nx"'( !esg,?v0}b Mu%0,ts;5W^)ēM}qp']N}iҞIOwE5Pc$>S.U{QDGNg9\G#OGKH<䛙rз8uoM_[^Aԁ݁z?J yA5DTg8וŧd{ty|V[xtR-HVpw@rV@EQ"d^yT'KnYyiNNڡ.g=n=^5ԬȂJ~ZJ]dj~CxjMChZwCHځ!kSD$_jڸ2EC/͊^.ߣ&|}AsTvRMm,&YTneprJIx^LAtEHNBvvovEoNG/w_=7ws/JM@ Ͳn[v/؆vϻ_RAgn9gQ7AM=/^aoDFC`b|MhNXEdoƻ$SR^)me VWKVy^=z)$lX [@]Ba7oF.>~xа|٠mЙP˕^Mjj @b+Xue  JnxV,Q; |1_J7ϟm"wإӧ2XLNuِS;e7;(;&xowwpG'Э3ȵݒޓ9蹟l|7w@J4CN6}B,.Y; ;2*+<8缙DYfIE1'JaA7!H^t@d@J&}(^Dۻ+yߩ}i{YȚyQg0veHߗS|^5WWeZt$cL?KeN2C<{]q㝏%8OJ(h8u8u"ñ1/ C2^vu|ÎG3(wwP}1SȺep&/'?%f(W_!+yauzI׏$^ "]Xu< NB3({g1Lr~3e<5Ozb sܖI'si\/a/Q 8Ӈқ;Z*jC3hr}7밺i*krE'MpI3 Ι2Ip%N= S.,immwj7܇.W܇Lc O.^=]Ű1l,D]ay%_$dUXUU,ꫦW]=3xW{o8Gog,n݅nC7D3!p6d𫒪G=8ss90 @&UZ\7?D&%jAÀ 3$}tEFZVPA!c Ѕw z#ցD] +x/,+`Pضb<@JrJdPDBU(>\Hd n(c!fT0b8^ .cX 0|7] 7Ra D%ARd@QUTյASC0FZזGAhZ% >h1-m-C'BϠ â>a X#8X6ꁈK{rJ$2-#`&+ֲہ( e&n3x߼$8XK>Up֒L9!dЏsLD [`b R ]"m2<ӷ`4FN|I|jF5)U%VWH/Mf,:Q#SQ6SL;q0Ct󧔟Ӕ/ollZ 6[  ɶ&`d (叮&`tFg0t>'0G;O7)/3(v)/_Q xT5$t/fN(sOZ=XA$: ,?q;i-i߭;Zqfs g$aq%i<27@E5ķ-^0JsC}7E,$-Zc**9kUj]b˜w|vL8Hd{2=my+7=7N!/G."֔o#X;8_lc>R?Vkt{Kt&N1''o()]&^'<>qpA^ʊlt/3\q&6bʗaá=t }s%{å{QϽ^asr=z{:w9GI~GX 0P Nȁxm_( D%ʼOQ{ko,n pg_nq~2 Fܫι7 89pXI֥Gox 6xtV} DJDsTx<1&,+*$".<+4l0$tZQǩ)OȈ|hNn%![ll©ZnYvL=Ip5hoBK{ϧ>=0"),0.:%'&1+3:+'=47ߘߙK_KMN~jF[n_*$_5 +οѩt|fz'U26˩ .@sɑ)DAjA0VPStF #Fw wrs8 C}h*y/%ңl#{Lj܇U^"Aa9QIEa%!Im%I%Ig. JRW,n.CGPPImǍ7+9L9he\@ba_ݯEN!ldv|FbJGח=H=I2=H 9={R9 s u"$`h"~mޔbf$8ΟGcWVc e_\H4 b6Qy'W9K>ȳ?%dF.\fٍMxGf83^s#Ԡߧ!>'u,F%XŸq67 ݱ6֎v˞JBv4N2:^ 3(G-!W[1\?Q;. a7밼 _*{-lBOPs +x 2/;X r|% ^g^Wpo,.ؚO OM&r #C`r=hVzo>nbֆ~T}ԐA_)ᣅ'' d7 ~|ͱZe m/NovBo\\D{01lQ@9+(pòI]+uiO5>?eTrhKSK9#@odB66L DbR #U(5T&؅ԟSȁD9~ Z.aX9rY1,<(X --}$AVAU@~h:TQe/PhBah1V mgtTɡ3x 9 VMhXY YT l X# q[F(ԇ؋֣6óf0~e:kwd&l.j0 F0,N/ktmEsx +0vK0ډ249eŬ=f/g?}2nޚXXnYRɈ!vF `k6Fs3_+0$DOR&M[gͺj~ /,?>Zzo1m5k1i WV`6#T%VN((sh + ϰKo0kgt8k]gvߑn:R:E*PGi.iE6:wZ\M৽w7. T/SJ#J,uFPxϱcmN[~םN9\sp%[9/)/c.svȉQDD"[IT|Kyơ?tcݥ;rrDM\LVCDk_#.]\2bN2N0ap;}mnjp@σm5Hpտ>LF[H?Ut6a}Փx51ƈu;Hu?s?,s?Ŭw?~ܵ#ng<813k+{WN˜Ƶ@CngJGV&ye#AN4Uj+nE9 `<95QuУkgאg^֠ ]}>;8]^sdĘȃw/l&Uydڧ&ů'8_fae}^1AN2o'wԷϫη׫ww_!n1N~>-Mh}njpG=gyNJ.3\0pl+gv|>Hnnz`' Wkjj n={;Mp*DoTZa~~K.|+yڒ{z˯XnͶWKDv?h^z m-QORI5Nv!u;EB>~F0hZ}PMktnx14Z&©u\@ؽz{3? +/h8b?n{>[A~n'~%ם鵃 u8u BY Ǟ@!1?J?ws^"P D ?8k<);&[2Z&ӊprqvNr Rc r/}m}{Y}#}=߳lwů Wv@4bؙtrt!R~1V9&*T8$kT}҈D9kՠ3ާNRO8SQLi %.vZh˟Os"zH9\S cqoϋ]0%kJy3sJC:@2T2ӱ7&c20x/JGcZFt>?МsAA E*"3!}Y#uWՌo)l*e5%o6lTUOOOu_jjbTU!SEʕUUIv+)Ź3>;P9"HCY  ~+$ą kj @Ki;hk4h* ]4 -PKD&h4hf;b&h}B]7ݷ_~AtP,P|Fe 5X*Ij:ڠTDhiN/V_Z?uwiwLsVDM/O4>N0[CИ69]TGy)sUQ@V`BQGB^W#~'_7kPͰIa^:k2>{GZoM4'f4_~KЛ߶t{0A9 KT ^E@cV$u*ݟ&_M gL2 ?|40`VެM{-pu'qWt^[>ԙ~f9K1 YC$V  /g4}.;I(轇=d"ڪtg<>LYMq)&\7Ưj^Y5MXwe3I 3FwLn۠zuFmzpA 4{b$j3mj3{in`iPhȶ]ɸ]b}] ;KƷHoؿ1J1 wV$0F^s`ɯYGw$‘nĞc>N Okme_A]'⮑{pW(˔Ö(#n[:< 4; >t4gC=_~>nI>g*?tuֻK0IOAX@V؎Pl9u؞u=)ۓlў} ;? }4/`j _ WOee UZ.LkDx>W=]M.2mFA4>-|M9N/WS4StS](G)1: 0w3gwX"C]8A ʻGH-+,{ `Hׂ)c.g8,~îaԃCe:vn>ZAZyN;7.]_??-sxwQC ۶WĢr^$,}F֋ gBizG=x V33ugkҵq`ukctkepoL7r>{sf=jءr:_Q[|J^$MqtS,6'v>j1ȱz|:c=۽RX^9fRvw]{]}S}SSSS(_((l,2ul75e?j+u(Qc/aβ :7Fy޵tj^O%[kzbW{<'zxX ak!nOi[^do/]W_t.tLT] .ݱHoPPr^____w@lS?8\~hWл ؓحmb Wʳ̢(D>=ݺAq⹖yGfgք I< I z._|-[U~WaKk/W>Vjr]y z鮖5I,rY ++"?-R!i :22K!p]!%}9[%*6bg4X1Xf$מݐ4L$%{dSc"Bc"⢢3#‹aЈa~`%ij蠈7!n@Ra_&4S(]+_‰Zyjm.'J7P5k yT.+ea1|~ ?9?:O˯pP74֋8Ƈ*::k"_;_.HuO<8w)xQBBw;v9:tߴ*j\l/V]OQ.TZzR⊼ylbPFAl #^XN+l  q.:Tt?Z0;@D 9E{wn:zzWTm)축h$LbZFO*ͳׇQO tt. VQ:֜:VTM(})e D`BO=(BjP2PAyUKne#GRhCrgwxҙm>έA^|o4/J[ "$roFjk"6/??d{P38rt!Ұ V5,-9h&倅` 7hF.WS?FgG1I) RFdnGIMדּMOy(꿏w--?&܄eN9Bpxsq1*Iyz'{976/܃Kv =a vw Tzn KKbB]Ywx;cF:J'8F6#^8 8s3˱S܅cFoZ\xmh6t<9 @@o@y BXXuX=)a߻*Ywu629}-vUmn,8zX62iv\AEgʆ?_yg`?r7뗣g#z8>څFIC@Vh(HȗrD( @OJa_*g%~\:.U'Oj>{UxѮ942*th$Q@STeA/ )g,R$CCNYoR4NK}ռ,5@K%KLiԤ&ȼ bA ]ڨ}]KI&r-__ ?4f5iѪѮ&YGnُd>蝐ywQ]) &˼zL (Pcj1G;u$2pQVY_Q?MA;2ŷӆ SF] Fo_{e2&3M?=48nA1PFAVVŚ4?/c89U郩[)h7ILU'̊U^W)?7oT~fѮԢW n#Ň# VYPmA&uh\+_@ ^%҉$Qv8mAR-ڊ’2LeCtq|jlTڴݱQf@& 9jWl_"| 蟳(d^"m_ Lalv2 *1(yeݳNٿ58N5:J#D09Lќ92H-R\G ]gGn:WE6$Gp0٢oEby(^).._kw`J2dqH8F_F +5+# -,%6)-1/>yMl]ؚ}exyUb7p5"-Bח+l=xFcҞzGѭ5^UʃFJn}]yAmYMiże U KSG+ҦRw%.I=Tv/4]BiڧҴq98E@=*CW^޿FOZ?lݥmdTf$g%/ɨM)H-XZ1Z=mQoiyR2ߤ,(cpN'~Z5SKDgHB'̵ δzȌ55!]q\4ڴǬ)JTǖ&-ʩiY%ꓙs=#-UzzλԌ)pM/K ;.4e-0"WmeKQwC]kmG]U_eyBhIiJL~QVrVAAFZ~YvJ~}NR~WNbMqyWx3ߤ',z+Gùt ׂ (Bhk&[*1h nl w-cT&Ee'&fĕFtF DdG^<͌(~Y6Wp""})@ N>wG?8&VpRib[v9WFҊbr)5YʪʶLNt:j_Zh!ORCK -+8_!t?kĞ~Ї~D5&8kdhV:tGx.ZߒٔXXؖ44nڗn8>cB`_Ys.0 > oa4ZGXKj\Z=4\2lS0 ^ ʌ *cwUuu vOEv zc_8s9faցZ/z5i )geŔM0t g qLR1~# pp+529>9?|1oqc`߁!rǟ5@CDDQ#Ҳv"eMgmbC\sؓ d bo7Ϙc]w{:m|h!q^\T!]4 G^ ǺFuBb#K* \hw<|yӕNok9\zcޯ9X=?|p@ >|x&(4!:}a;R;6wU\x;eh8 Ѱaw?Mb556U)[?ޮd OwB/Dd~?$Ād+ += W2m_;(ZqWxd6H]F~5VFViOǤ>]_ +8P@?rğ=B$w1Zf2?ld ~8bOYmx8YʨC*ΑRJE\ Wb xNWfa~7~؇S@ Y7Drd;,"="X^HaMI$ձ TNr*!8a!<-pL@/Jor7 1BpFDˆlB"X\Tˈ)aE1y&&ı0#cGQ" ' !  V֗*0}f֊XM X9 ,O+/hê]0*biY)5`ͳ2?|z$E'R{M,N VsO rQƚt5F(f;!X{Mr:;wZUOd>迒yYy^b_.12'e﭂*X/ %Tנ4߮MGWՊ_ '>nPdM>'ߛ\{crOK&c'XVu`ۘLsX(bK{elNUŦ$E"/&e*LkU>|0R~o֯lT:7J-(ܣ K O(<~!=Zb;XW6 {`?:pV5x%70O ﭳZRiӨ¦CmS!'vkTۭWyd?a/*qtujU{uk 6{`=p/i)*_\59^9h=sLzXȩBs}V.w\oR:vmuQvAjP^h^ps u]`l =bTlz *$B$Y>a*պ7wEF|j2ͧ c6>L?a|Ǧ{wѱ_l[ vĞj81!!Z_Y]_4?GK4?mq̯RCu[-w[cZa͜fyjV=ͬXaqJ@ Y/ΘOPM~o,(O:C8fb ̳Xj#~[`\PÖ^A#6gf{gr`r^겖] C=DpzeHSOՈt.Z I5GMwGn$8m tR!u&tThNq1ΌZNj (p3!gϕp{  c( fɠ {xT F[bl7DźHqxqk:(:51515qqػѧ}: W@Bį"E'.嫠 L;ʡ)oIg$ZG9Mɠ E/Y]UH꤯ZIctFmbtDk:%_s؟恟 ^|>t+c%ƤŎsT :SNCI<lFп3[jmecW44=X{xX;eGDtYt^xCnbEACa}]) ̖⠆Jv}|#\?R?R=tiЊC㿅_lDD,;/rK*=\x wuK|G 8]LOSZ2.9, *,libmxyR{xY4i8i+(hDaⵈ¤¤aI+8$Dx|r;tZ_k-MrRAȃzJB; My1feFZpYZnxIjqdQJUTaJst~jO5ѹbSd\J}92;u>";e~"t RCSbvV-ZJÝGQ+KsC 2T邘r^fF}\FFg\ZH\JL\rƾČKqIyIc3EQ Q)?kP=($Pŋ-,L*\Qؒ-O C* wƇ->) w`ʠrC{GVVv vwKvַ+J]hx$NLEF4,?SQYS|hy_\Hxlpvhv蠲A)݄yD#'uQO5M[_3ȬÈmH`sҸkˢٵQAAu븁uNsXw9̚p6z@`-n@3<0@#|MN5T q]ѴTvP[^h@[Yh@{C'>ll?ob ћ1{!`L$o `rQ=kH}L 5k* )Z_/m$<~9: Oc2}e ~~= 1_F6F)ͧt?ƍkjpqvgG`))T=C($M;NyʧMjO0"VœFS&y2fSkK=}yvY{VW']vZڕ:9o\YȁC g`@/D <߄P2*٪ I9sB[]P#7j26[16q|69xopm,rڴ̞i-u*M<6t}++o6n\a bǧ92a fDIyD\eRU{}} ?c=1{RMPVm3t7lo˾#.{8y뫁AiX@9L^ENQ)qZ9m*xF 픇)_5S.Χ4Ng;YpIl)em]U=\'e߾,0A- c_z rzPdS1ii k |6b.NL㫛7QoA" ߣ3dhR@ 'KW }=Ծju/UЇrGbl`_&c!>rXYHk +b}a9l&,18T^DF6`%c @ ˠ$d` Ĺ򸇐c,^"WDÈO B0䱨  "XMP뀮 M@? \І5o`q诗)H9X``0), rıhM"Xr0`BlƲsBXvBr,Lwrb7XW46KcѻFo~iob뿀A_R J*̛>pޙ˽6ɒ}iR$t3z'fRͺ H>4|`NŌ]mw,Hܶ<-~_V%Zl9/{_ B;0 ;)T滃[/WAϬY?ɗgS&{v-&venJe?,}~WJ_q')KX{N:`X=V[6ڪJ"Џ":e$F+Eᡓd:7rVRpťRz \λ(sU<6xm)'ݎ*\R:J|Vw}nXs/6 k/[HI`aQ1KMSO9\>IU`K1j=Rz.R?Yg jqjQ #AC^kzMiڪsh5^y}7{a_)w("?` ]So1x>} t]ǷIooNzv6V&-712a<3b|6c `{C7wJ?EDoru.[ caFd&o1c.6¬0̬5l64a NVgMNc]6_bUˑl5ÿ???$LjI{q*O㙓ŸHV nͳf9g>j"zzfz5{z=n3f(`yہv}wy6'I;6%ѵDAt!YL1;(3KqsLDdx'n '~aaS8it,w 8q8p68qqvqi C ~ѽ$[i>ΐG I3Ez$24ƫcQ<)^brnn['m9q[;ܛO7_hQu}!s}~φreоEmy6)jS 9V}ht<϶ϖ*jSd#1ӫ>rЫ.rV,wUޕρ/'^ LUo޿@ZCؼJ`*UrmpS/-Ģ+)¡=Kl͢Ĕ.iW+b2cfKb\+y(c0]Bo_D\Pj?^">Z8_;mڞnהV@OY(+_W,kbǭ`-e ]̋{ 3jx]Kl9;_$:TJ<#?и9cSRƣ$Ӌ2AyuىCw% IM>(-G`Z"XCgso-,T *4^mBtZBWk-0/ Zu.ˎ\@_RRIIiS %ŧlK9KÉKy2 aN/@1[MD5hM!qN"^X]V6( s(*3r2C2 yK#b3"3{Qc̭܈܌[a9B#2pB~ t;2X'UߨW޻A4ɝ-4j r]/?-4*/[Ww,,8'8UhpА\q`~/|mDmڨ͒Y*WP_R`XXb]4+,?4)׆K8A%BKfKJ_YE_جoxEj~CBM@ED b^VFgqbGut95ƓݜД`63j}G͛h^kT^> ߸ `-g!{a Ke#:bĒxYdѐlJjK//,7.'څ"ݯ;ӓ]I^A^N]1bOagkN]?rNB gV@S^rL-Y fI$RY_`^b6x{ j{HȰkAKϑ?-<[lMYv!?s(*1:!X 2(kJhA$z"6CS ]fL[cF]j>cjTJCԴ~}Wt]'94p7ZIu:L En]PB1; ;,Bv8l0Ӕh<5)"]%jlr^鼽Qi{IU{T_R{lj 9k`',OLЮ""2v?bQAG#GE=I:a; ?+ow4]hͱcƤ퐴;IRxv$)q!?0v{~؇r= rǟ?D &!S|ůހނ,,/')OsIKIQuG@sb{=Ά#d}!BH+"c2I Všb؀_[C c"!K"  c5@q _P[9#"Q# F$ '$,j`΀I[ M zRXi/-מd!\$0. Q1¨XJLh cb?&vcH4Ͽ  != -+ ɘჟ$w {%$ű`XP V`:2j! w&2Ud IgэObH>"Jz#vR53qT }Y2p$3܅*űT(LX$Mje>t?]Nv;q7r3|R$ ˤH_(|`E,,%x?$րw.[KaU$V.E)QR;bʕU_ P"?W'?S!?U#?QkwGMW_ibX&YV}u4;t$! =g:C$^k^hg>.~S.HFn}z _#p`R,n_ _1'py"猰YC,~6w-k.}0EOI1J=3|d)q$YiMfU7i&tռ[eQK-7!a᳖O[9aR#u)2Bap칪 }qy`)U5]5GO8˶ /ؕnL}vS+$~s8Fz[$8B|FĒ%>W!c%tF\sB䯶! Tg7Jge ְ V FY#C~AjִQ?kQ/q/n .N6[;ޟo93Dû Fw ot Ǚ Lٹf+Ef >vy|{y{آ=ilgl jԪ)uSnޟ ޟ 9y{k$ёDi'Y5Zp&Mj<[yU$Kg16$ZvfXw.^ZbZe`ܶ9t1t̮!t֮>}m%GB>:T`_o ~/*&2͹:"׵*miD[yD#,R1^1^ˣ0GA]{A<%? a 58'6@_x i"{wL_4^SRYm<׶T$:ӽ$y.*Z=AˉFˊ>u;3Wf7jf4\ϵpi?\5(l|hbEȐ8V"<[9_.mRfSTO)Krsx>YjL^ =GOѓy[IcD+DWox3;m!8P}XW*FK]Ů⭅^ ~չFYVENRcݳh鉙 f|B7pt /컐a݀yK^ ^,W.ꠞ K2gѦRlM1]_lMIɈNHKMcEDD.঎n`qRBS09)9)R0c!Oa-\y858 ;m,EhJ-DH-UuK=+}TJ0u Jئً9y"$ 1"12 @ #!aE2/#70Q[41Ff{8AGF<èQZQ!̣oh}Eg4>ڍޣc-ޠ;5z|FF/ )>s >F4^ȇQFFWF Q?&|@kAw=΂N;zAz} ?0a!X7)V E-d/˜%"~sJH*Iuw-ķ7WՄ ='@Oɇ9H&/n c-L!%[)xס8gO('e-EI0bwb ^KI5HK < <%n@d}$^VK滠-*HbeII S搜"_++Ɛ(?RZw_tWtGxKxSx]0Oi?P?C~SiiaI-,'_VCZtrFrBX]hPswL\[ډu] ezM +~7Xw`5Iӆ|;it??"4~/^#,mEրC[ `8VJ[੹]'>WMB. 7O8k'pڢD7'-k[6 \.xĪWհA1V3 >"N{۬߈n. K 8Ug(]H_\eϝUIwh)tƎ%rҞ+z>ACA|b{8։rl%é_l*9I-N[7;tN|miWR띾L8auNXn!^w@o螻,M;Ŝ|U]b[nh靔dml9JYJ&JF622d&7ʎ]ZV{ŇNȣlm6(R3tI[e#Ru-#Am5#]}>(VbTdԪ0Z4!Ƹf7cfrEvC6{V:]vUp:̑B:-ӡ.l@pGsJcf0uW0Kuf^;_FQנyΠyϰΰ9oXÄPP+T,B7J hs('U\ fs:<ölB2&A&5SՁ;ͪO- m^nV\w.< M h2:^x0]7Wje`ZnVg^\lQ\iQ`4Ӳ"xЪ,xª4xuI 6EB AWiz8z-h*k C ZbDk!gBDkUgjqjA5abɶ>9vKli6V^k-,է=yTpfE|ea0M|o xVo gwBХ2,Hɝrv?@mVoK %ԫ%ǔRjRgmѲy>7=J]7. _ !?NA Wij9N8|_?C(a1!f")+R ѤDj{HСJzj\{4]VVwYEy U[*]հ_C_9unW<2#ACEktg1hsj/IU 9@EpeQhb%eGGFgemG؎ܐz%k=Ej_  2QY ?8xIx?%XJoFΘn.41) )۩()IEVK-[,D-7M6&l2\xⓨ7 jð!Y21͞l= ѷ&\+!av-vWvvɎ8AF;JȆ;;zvLǧ2Ik>͹[VПznt+AtS@ ~ 2< ݣcDcDcDaK҉vpb;1dNE2 τ 'A{x6B 6o2]Ѓz@ |`G4߉HCI$E͑e'$r _a#+<$p%_D|W:  ~)y&N 9 yY`@ d%@ 'Hw Bw+!qC>PE!|>E&O7cP~mv.h'6(BښWA:BHBL+a^j!`7oz7Ef> 00cZ;;j1ڔ!⺺=3 ݂;wB{*i446M[Цo k}=uϹnyD>ʃW3"&zx$e@ ,F @CDzt<}Xp!G:(s^E>~ /pHܤ#!1o`A noxp1pgq`;? ,WKӧ; O"_a ] eĠL=b"P"K6RT|[~kxfߊ|DCA}81p@$~qx|ߡH^l"+PWF,V[VkV}jYkSV/}'1z̜s>scwYͺJޤ>z]OLJw| H[?aHłT󃬯2dS1Ȗc:z_ޕwdmQz(nzC~?p)^o-k2WK"K{~{z&V?S{|_=H#PkVZv;;:Ct[g^՝tCw+]øwqE"=nj߲N!vP>੾i0%Dzx4뙥2;3]֧Fb;10b3Ie2c4+c]7e]3of]1`]c]f]`a\`\b<:ayVիbG;do}V"V"=" g|G;ix€*'MʪxUsv3vvu-cܣC9V~>^I=ŗKn"/,E/!2j!?8Y8 %N9GJwI:-uHP,u@P)_P/W*G%K0 S0&:-uAz.-Ge]/,)S9ן7P ) "kb/ݡpXm< ~T(>"3V~0M~0O~T~JaAaQخYأI8kœלv ^+MyS>Q:P Ejke`/!'/ ~ Bw!@N2 tﯰ/By/Ae/Ce____~}j~kM-U;1wKc}i ^(}(hi:[fpZ V!8Fc:(Ys}PֺB ZѠ푠.!I:}At{v zG#5"jI .࿓y>^aM=H`-;HxOG  K  -4 m0 m73 35jnzĸ%qsLB4i }j"ZK*thLk1ڕF[L$7x_hD Έs%ѯG׶(hK|vxӌ;2?n7?74?'Cv'츟㞯ʎ/>Dx_(<Zڿ ehHƊ,Yz6gԧGUY''J2W% W;%6:$v:e%8e&:'.9%pNIy>Wkߵ'zj#p.^Ɣ$8|֯;nU(Sy!ڰz=2)]JAQzakbړ۲|J|-ۺ,̽LmL<ۮ{c[SSFKB ΣG c7>ݽ0{2T0C9#{vDܐ\`J@f`ow_ȳУo{&]:}]{i|s >xØi`x{ CwP*76̘I'NĤT:_9`eH5M -"Mx Fe|Dy|^i|EeDZFRj?\%.#н:H~pN롻f=7PO;|l\ uwUtKStWtTϵ Y5{^f̗Ҽ_d˾xw :x0Sh xZ}w,HҶMОNCπ8"C 66%a[a'aO@(|j1- nI 3_by?.;}q}97B/{0ǠOB>'IUI>i ~.ʅHRB I e.ԅ $qaq_$ι_O`8;? x0\+D7ĹL;ļ'O\C0&ݭS9];r9~pxN;g^@\t&!R| ",ÅW153D @vtL ?18>Dce/<{~ 瀫Dl*iIc b|ň [Po"d@}֤@@,crF[#J;qBn9Go#8?PNn__2% E>SYI) hձB _އ4|_=RaT`E=|6Xo1b^|i P= #K|~D?Hs;">bB aXoO怷|5jW8z1b bP@ 1" b<8pg""\ iO7x3f@Fpmnw<|**z)$g/8">bb g*UZ4#gdu~z5BXtGln-Ыb;>E97*!].JB:ʟH,Ux'%P~%US?xK py ~\zӾ`<0؜ PWMSU-VTWmSUUQݪ{@m67[}F &K|~70ǎ։ƾp-EbA c.rg*\ =0<PPФة8^9pvc^:utj>֭ I:9 ^;bJ2?.o0¥K0xg(|DJwXFgh֚,Bݦ Ɛ:6>qꐍ! *BN6, ~bTaI%e/Q{࿐{R14hc,M'Dk8A/]+W=:D%2J1"A><͠6<װ:Ĩ2huxqyxqiIIiQiAqfya}o$7LdG n@w;dž4IZE#4{nWL[RS|F]lNuL$L ¨z!˜iˬmVQGң[E|kEZ0[ƇhדuP28&4d0l.RMiBʤHxT^FlMZlMJMrC Wlcb~NYx}np(BԠc`2Қ|XsD]|iĚf&%Y%eR m+{b'b7E'Jd6mdSx%A߻\RC A1zDZ-E|nUtYRanFNv^FfIJFeBZMlZ]tj9?*OKd.$]pU)_ن$l^!\q?X lo-b:ʥB*v2dQP>_-0D' (>/":'c]j]ga=j=* {yx~Y_2eD+xp mpj54g%X V@ᵥJթƘklXEyU}S*4JcLÊ-xEŶE56~Ekkߢ9+=E-{~a!,RR'Z=hZE`{VȂzU6MTd̅&R_UVmTh_i[Yd]Y yU +gM=+yT7tȭc&e5 6?W0o=VhvXMkkĒmBV?Hm}tCaSgSGS{Ӑ[Ӭ[.Ƴڂ7 k9\\ש OCo}ok;}Ё=\JgD*/QtIQrUrPtnVO / Y56?=_|[^>w(98B~33cسܦli/q@IttԪl)۩R)ITԤ6q;ɏ9f?rMǟ)]> `L;sܕ[=(3}%yQ%mg.,C1l4bbbhqi0Cw+ :cjҞ{C`d 'l5X ߗp}?֤U!zdל ".כ7/4eƾRRD*{Hi,)Kr{.G$k+tP`F_C_D[v9Q} !пY|BOI=iI'$u҃$N$<نZLJ Iҗ7+X7 ,?k37 \`<9AdzϠ8"t(Z6d_[ "-{ ߗ`Nbx]rHHp(č8ILq s{L<1A $ @p7[+؄'s/r|}^KWүaɛ<2 Lj&V'\0a7:`_K 0u58s8|0iyL%^+_c 1)U FX5!qB &`@{6^?)A+Aoka|>q8II+??*z~ x$,"ivC9+/2>d bPG ƈabJƧ "pO=VpuwJ> W '4s4<ꀯYA 1#kƟ$@g*S\!փ|ZZZ<>Iy ^̛tހ:>vY";$JuP<}8rKWjS\Zd9,Sf;Σ5bUt \EeKQ3Y/?h(hP$SIA_KJ>.aKdB]V ʩtV9N)J:ZOU[jQj#tPmP}[i>ڭqviܤ%wi״U)c)P'}Z z$Nw5躆]q3ztB?$a :hO ha51jFm˨v 1n)/Gj0Dz3Ff3Iv3S3_׳TdzZ˳QӳCs@s|F] ͞'=_Ul@{:gj68o2{c#is  +GaO~^pn8N5>Y>>J->JM>J>>k|fUj|T|VPyW[w2o? (z/sHBLsaҴ>B"̙Ca7``րHF4z:b**&JN ariRmj?Z+f|_Mt МΣ&SwAC1&h[vgdkP)_.$L&8F28IsuPVyPViPvIPNQpNAn~nn^vKA/2~]R !5bAlNPDCFgO5Q1]&W22X,lOG I1̠< UR,Y|nMx/ՂPܨhݬD  F.ӄȵfqf{b"ϚEGait/ύ#D+xF_PLcteR[65e3k3ث\$KR< T53#tS cSMcsbcKcb,b;,"cG,"bg-cwYƞy yhϦFVp}?ؔ@݈-Gr56ׄQc#V$^.ᣔcdeXdXmn8d4c" =3?ME&Xw p>sx>IJM)TETZh,,tIy)$gjGeFg$ddXWYZO/z4NcWO32nc}\q>U{x-eRERA#̎^"\"/S* + ʏ7K37[m aU+5cuReye@{Y[zײZeǵe5]J?t.A˩mB '!AvkX E*j8$ MV&>;U"K&_>TEX^V)+59N:nSq=X{Kɡ?TWXRq5h` C@GjЀ٭Ноrӌ:mA 52Q.IJNmJmm yurm[dZʬj)Ciem~5_ƙj6@k3t/w_\ PAw'nYseR @p]mhp; 1 ir :crZgpp`MNy!D*bm6Q6X#f2>22?4_.SoobzP%`w1G qhIC9̲f^5rޘlށa20ċ3z r|3ia7sHmv^ IyKR`,c7<,x0\x!eրlv&%5X'% R]#%WRZ%ťp_J$7cGc#3W[= Cv D͍{$hnuPc:Z-^^D3T#G L?Z}y/#"<> _,ߺIaxT偯|k_+:Ջч?QCn| ? ; IĠtWc$e|U &9x7!.B#xx>X]"M؁<@ |An7؊f/NhtQGΡgYG_@,KRB +@D^IO!xS_GoO']r>y,|3G( A9t,/"eO x!6߿Ij6A| X)<)jԂNMNME- N8ci/"fNXNiڎo $qDPg]ɰ+b3:)o%J>,CRt@K>+GeFhzZH;dha*ߠOhv):xKNO0ܾ WÏ nH&tZOTtH-^dڭE;5 hIvhT6ڪF[4i -hMFYFh9־GS:OhRZ'cBG)cHPcC.^/aXא:ztPG{ ]im7 FhF 9ɸ+hΤfMhd MєZ4uqӽ#C3LLEe-{ Z/$.GM$h&2VBF us:9e\c3'x:Z^ s l&Y6X6X}6'zl^yO[v56"x1wq={q9{;v?81l3|Wb&1~ {g~)_7pzp9c9nnQn5fGM_K48[޷!sMֻY1]#O @%B%N%E%Kå@bKDKDKd[ ^L`F^MNpHFpYZPRj|3xޫ!97B)֢fA/;vUG#X#J#A=M=GXޣR֣AƣCcPnz E2=+y|P+BOG @ 1 CeC?@''$)/*W#_$_啡+_«L̫VԻUػO{B{r^\*^fyW%grHi0hLhB'LքZZB܆ WoJ r)S.KQ.V)+RTkRV[7K#{Rj&~zjɾ<fb92Dњ(j2gGTHVzʖ)b}N^PjN`zV`FF`fz`fj`VJ`vRаvb%:ub?҉ Q+&flho"߫݉h`Sueq@{JQs&Ǚ0cmcŋe"RCc5CSCuBuBkbCCB#B뇇 yU?4CtÂrlHF s?@<-X{JITd*Ns]bi1I!QQڱQᑕa- "F5x?~@zVp^Ht;^ 0é?G+bO4%*Oף4 f^;+E"-S6)W).!H-*>B;<.N/$. (600( ?/no#ޱ7b?]+ZLF`@ FVl9*֦SFVXZxbtlBdZjXjfPJrorOrwrWr0eB3eQ#導{uݒqK]-AD0 z,̳sihA$SF‹I,sb]%#dCssB5tY:Y:Y:n]nZٛ5Y4\dSS 42.H>I` : ൬%[ʡ2eJ*ףxx1vbe.ܐRO_9`%aq{QkQDݥN͹SչhLũhAٱ蠒CUEw(=U,g/c?6bLzRsy;e ;wAw}snXlG7bB#<qdx0MG#LHS7ch O&6V%7ImsR 7 !fwwwB!jp;mZ@OA{ s U7.j̢!I-Z"݉@hb-c|3܌".̢C_E!a: 6tC=C;܉-aߝп0j>n:v~+.8{3|܃Av`t +Dw;]zG 6 |m;Ѫ]h=]aN PH0ƀgGhODO'3g#]ss" 78i >=r N,p\dc2*jrE|L 0I% 7&7+8+`1q>꜁oQCpiUc %AB/z nW!R41QGM"DZ !p  Џz>!oxԣu/0kC?.7Ǭ`=bBFxc&$MiIѰI TҠi=Qi/2ff[fk.23Z>cj6{j2.ל淸m`J[[2&kyB/9ȋ`}f//+`vʘj^jbجg5lf59'VgXͧj9Uhy.-/`Xf^F!*fX?b'-f"v#aR-S͟T9lví//,QQDh֠`l'bps*jHkViq6:78G9'8W;IT:Jv(wi(s,qY+Y2'US*t-'9?Hg;?D+xK`'#aO=T.. ͙͞vzK=PO8*w*uK.q˒.r+.t[- )>,>#C.|MTSܾKqɥ`Ct70ˈ显\EM~&Z_*'ndt0X@)'kR aB]1kP1kJ)kRrr=Xb=W).Kp`XXw1 sըϫ b9y~^2~ra i>1>IJ>YIE* U*-}1Q["}E^U ǺpoTýW 6>֞(0 c9&ƦpeZG°Ug` _ ń帀x՘4|Ȁ FqA4.k<Z=Zh7f@? DaAAʾ j E 5n k4eꂄy5A^U TTuU)湚SH"8@s> Jvd)RBf2mXaYL7I oaz{zkZKZszszScCE SPKE.鹲]HL:`\#@W&P?;1/B /4B+F`o/q w΋UpKUpWU ʮ-*m}iexYZg)g)?  fb_ Y [aF^L '1rwscY,Zڮ,EzUYmj)I^٠uٌU.qҳ\7ş,aVY s|kzh p@a?0ȫN<4ȭΈuVTg ضu^]$׺.kYc^6gN,kN_gVeX3`3A "0|;p;g5ڠ>[oS"6m3(ydȰhwgLX,La[ Sidhn'|4>! 053ocЊk]3ڷz%ɤOtɰߔmH߉t=I?4H?I:Ho{IIw$H;x ~zEC%w&=֤x#GЩw7񹷁|D;C PyEŸ:pOc?nL/O8 b`"Q77k|ɕxe }$W8++=3].d;q."G>8͏ p k`΀߸KA ^&*gA'ǣ zGi m\`YS>22JWzh#H7Ͱ'B2c{4lߣo@r^jIPY+ZKh/puObZ0>wCaOp! gв"q u79tЙ@gH^!BgIO8JQI?,x>Ȼ>p iFY,u>ПD*ރ#hU3\G!r)_0^r.4mxBzuWi4~xэx# r,"=Zq/S<|r+ET#{v ^p Au"N'PޅnxDvcWGX ֣ ?.#/O|:9E'  79 0 {F؅6YB܎ZlÚ-hiXvЫf7o2k`Ժ\zs)G99/c]Qڅ6YW}c+W~3[P!gWܲq0-?w-)!"lu+4 nD!>mDQ@4[)nMsh@6Z'C#4&1M4"7hP.K}D}?P3z0=M{{02 0{" Q5h4>49ww\ϢB`f*y)Нiwq*03&r% %%Wٖ&k.{l{eݐvKeݴl_'&ᄬwSȌeӿiއ  9voNoL'䘳r g=n˽\f)dLj9sVf=7Ͻ/<^ʔ׋=YOew`^7n8_hV?o"x@`/F,xXӌdy,I`HZn05ЗiܓoҕRjڑRm֞h֚aޒ2`ޔ2nјҢ>uE]˚[-S/-L}|AEʯT$iYeEҼ/༚R>XHxܔ UIJ,.f[h (xCGfIkFisFycFE}ze]z낚2[UdYg.~5%m3)xæ}9E_X歞9Y`=&`,*gcoNWA-?Мd\\M6\+U3l[3i[3k[.?]nGs^6; ۜmrmyv[Z^$%mQ 1HOtzIki$J_W`\UjV^mQZXhUTPaSPPo_n[0hS>p}VVv K-x.5?yۦ^B9API?y8Fyݕnr*\[Yg(H1-.ϴ((˷-+.,mO/O+O-[eR.mR9IJlJ >I(6;0oWi`%yǞZoFH]TJE}>F_XdWa]gQSbZSm\bTkX3fP3m_:U\V5.~eAt_DW~n]utżU8ogP{oN$BMTŔzIqkRi70ZLҚs̒-75Y5,m]Ӽ2yET󨦳ME4bYX-꾵 _p|µvo,o;Ns2HQwINdukҺcu),㸮BӘ FȮ.]Sa]MBD;^6 j(_&ߚ̛]h RmE; mAo,$}IR%i(X4C }P!|(t(d(xh4\8^0O?xZ7pwEO>{|c,|"K&!A?I8ÄDMIDM*!)mDF;ц1XS<ƹ)m^q}^\' |qA{`=w w ܪT2ƽ&<__a&S?)~S3!S 9!S↩麲 W&ajFvbZX.}G&?%_|^ n h) tJtju89Ӝ8\%\X\-G΍ܔna!ʚDY+Ѭ T_Ⱦa΍pNSZV??qA U+f,xm@mͶ$QeS)&mtm$vbi>_fk];μ F9&+s.M^=ww;i1tHrA(p?;d|):LOeIzCᮅ[݇bw?鵏XFN1 N p5qHf!ȉ$I:I*xBO嘳!> P+p&˷w3}N'>nT82 caȉ|\bIB$'851i:RTxo>@8SWઁ%ވ#9y('~&buCc$1Hd~$mnhrNg(^߃(:xksς % x 4{QB{ l vS=UkpE  bv4aNR59F 7fOg8uK3:}S^}a$~gt?vP 9npQ87"SЄщ'Oc(IxVk鲛A2og]f8]G>_oi UoK%\x੅.88.?MwI߸H\~q ڜ=N؃#ۃ߁DG~+—_\ъG?gg/^+zyw?#K߂y<{@-x<J..7IcNrxS飷#q} ^>=fd'%v[i-_[}c81M˜^ӫӟB}PWWx[4#-\JS5<ԣ nY;p0J7Q9++^yJUF7|'3\9ӊgLr r(!TdeR&;LkdiJl1ͦClL6-e|5)3GdYYeqL[<-+-ߒVV܁G0/83y23 NV74,mem$Kl_) ޾Y:tʌCqX(˴JY8'+2CL:]NOɄdcsZF]ey^~K094O<]uNzY'k=d#WV{**YQ/+2,UCS"phf(N3ڢ i&]+uu-uo!0ox:vHDk%3 WT^FDF*#ёDmT7*OU늪uD5ۣ}QCSrCc̜>fQ]Qژ;c6qesʨu8/Jcғu^M<+m2^xKY"~J_B;>Vo2ʌj㛍⻍kGL㗚T%̘T$l3-O8lZpδ$AW̊7+|gV̽jʠ2YL1N5TGIYӚkJNs"ʤJӊA) SK9krENK9IY/AoFwّK*^/qb/Hl-]pmMF9&fe魖y}c9ӖYdfXq2=>˴,S߳LMeZڷiW>;v( `׋ySgVZ1E}:/DS/M0*I35)Ωi^ӳ -gUjԂ s-H= 1eB \ w;Yx(bָ<S?tͥQ*K$H).rRL -R +- $v-H,YP|A|z˸EYk]ytQYDc7oy p{֗/#<^חkUIqr0Mve>"("$<,"""b"byT:Ȋ=fL#*$]BK6-#lG݇>Z5ho%u:)\zɨQR룴Itغu8A' ,ѝM|ڂo7@b<%-P"8mTk.5G= Zk mmC`h[oݥk=mG֧w':Ư ^ ?rLݏ>ro-em޷ q=*"aJpo&7K[6qi{'4^3GŽsv^\;qiA{ pRߥ4nl :ѝE=#f4b/#_|8Z& }a9F,p8lb;| ]7ŦcRl~P¹ U-<wup|9wߋuR\'e{PLdO&dLdXN䐘M.%h1,>'E7Gâhײx#y{68C"Nl~q H *&F |Y/';^z(/H 9˅ :8Z((!5cU=8Q.Z0Pz /<'~fOrjDȡ>KTɀzTP~=Rj31K3zj*FJFJrM^,N.S>o5N訧5npW2\YY)Mr٨&YmɌvL*m)Y?.daYYI&> ey͞ϙi~Nx~iv/ca޲$D֛ʜY*J̘T4˔E喋d,YZ[mq=2fu\Y_֏Ȱ/e{ |xn>ȿ/C߇SBV:$ Y'KKdұJ;˄c9v˨Ӑ,t2NwJ1uCz0]^.?K+Ft<N9Y!5n2 +ܼd{,qdȒEУL=kdгI<;ϳ_zFkty}DZI'_;Ma;МMB4 4ؘ$ga @MBoYl!\'Y)i%JrI&8VW)6*.2,2/n1+3-0 )YK_VPKcOu(BobԖ_*{ TJR$TIlU]J҆WeC !U&}`U>j\_ZWM[uT[yQSƻ7ʾ{~o8i>uH9VVέ{:Klnp/ o H%1A lL7i˵>[8lV<( G kcRkqZƥ{!7ù :oZ}G44?M%NįO|;BŻ#F:Rģ#G;J7qǎбI]ym{DlZ%mĮ;e/\"j5pPN ;};fA^<-ŽQ\=Ź?@#ġ?^v@ljE,ļRL׉I^1;-F%1w~&&_؏48Թ i.oa7ͨXrQ/1 (IB1n^4=:FVLzt_@6Ixw-%pP0k9-FOjhh2e8,O5|– tM0E*|;oLF%-%v&+.;:ǎ?L='{9o J0N&wBܱ tt5b^^=Ą* T,ꜰ=( E' Z&SN2M[c qlD5t$w+:kc gwdY?Mo/mwy9E?=8fOQ,X4|da\9.BnH?D|;Ȥxd1< :8nuNNS8p'ӳ6gÂؙqN`#mrʞv$1Oeꃻ?WK7C04+)*q@*8 ΀vpNaQj7BN.6ه2MA -G֣"z"чc|s=FBѯf&4v4^|#S $#LoܼiU{`~5 oh? W^A_|}:yx% x4)QXxax'7Qܕ-Tker<Y?}=ı8vvީx\}A&6o7^1zyz@ғgif q?_ 8 7^^Al,8 j8hVxgK({cs{*=S|M d*fg pjѫּ^KJp0b)5lx )5p5W_is^a9H@KL,`M,3X#mA$ R$JepR) єiC*5E!ڂNm~67tR6ۡ Ev.=q]ji!_:_,9c`׽[@CFKUGpňP8"ZS͏Fr"tYx1}Zb}j}r6}RQCbCBԣ7 3G|7f<)%7˝%`!u'qz^k$R"E>Fh2c1}*^LJl!)Őg7ů6o51Daf{!QTF')e}>X2|0x%PiV,$?Qr<%3)@IZmRR.!)SThM4In2N1J3H6l a) ɏC_Ӈ$~SpMޫ(s>0.0. akZt~iR3kX:?A (BwfrX$YIByIL^DE(yqмTmH^.(T_ /Oi}7j}jox={U3:o4\prU|4WڻUD8HxKpi(lOiƻVUڮ,V<ʖ+k)(yP\_(.ָ| :8-pPI!/,Ѿ*c j ϚDq'qn5ZS-5T3(5KšfWb[uT,6]7NHKp6<2x]5ס=th!M..M~&Mbߜ*vybc$ͽb4!fM3bڴKLOq1N &i7 4 uR2Nދ;ofA:ĶZdAXtyWv%IW&FjE)΅ i /a0< ћ$ot:89 gg%Up; &ڠَ^wFLD?h'AWQ}H" ` 8?Fߠ`6\O΃[b:z~"ߘ1 8N\#$ 0&h q0Kwcgx}𩬀-4MA5.;xF5QbATz` 81ypIg%l% ^I.V)c{H/;0b rsNΑ4eKО|3 0C3rsfyNı!ɗAn~=?ı|7|酷U]H9f>@}= a3f8ql#|iC{(hn~A} -ôs7h2 7a9ڛz2V$7=<pX,XUOODƉ2tPGX\ru9u(99G׉d~S#7[x<N ְ86 !'RbH5޽x\K܍pw m/?J*ʥypдL t7gnO_C >E>m^DIu {ijx‹O>:RGӔw;\*q/ bWO+/"$>& 6\d&b@qؠ=Qb!(x|L|"Y=(>a4c %;b'Tݭ(諨h/7?QAQ $EReG1.7x 'T8)R8!i ]DK!֐M"'^d7@@ƈhth>=V:;NC1_&khUi) rRI% Ai1-ȅD=LdT '>f/5S.ˀ[ 6XpZ5洪ёCKJrϛ:?0N7&c_cF;i^>Ct);S9&Ҧ<^VҢLZ_j89pZ4JĵH&62eAAC 2(OzJǸJӤMMd.f9i4) fǤԙ]_{T#ww u7Yg8Q]2`)}c!]ұ UڭͪPZ˥ٺVmZަ[XJvk/@*J)&%vn\zm>ߗPE^hob >[K9JC49FIc;KS8KST:7J^Lː,b)r&nj亾*9rƓei@w` ]7sib_LԺH{TJ{c<21RY'|ՒE2})>t4_*QR>kNQ=,т!,CY`֘J,Rc,>R*e>{7X|7A}$7W+QL ^%-`LI $n$$ޮIxP&}omwo-A|k bIi:JAHvPdAIJZP&5P\I i$tkCiB1ѡgk#B_FY/]d𷺣o /;rFhyC$+n*9v&>$E* 4M\D66LYEF"£6hâiCNkCG 68⟺ou(3\8g䱆%X9/DI=l)gگ_m$v5 ĦQj=IJ_kŬ6_#]j P[-6Rm;0dyD)Lf^ _?|ԕKȇ;RtW WC7jĬTZlE"oѴ0[D-$UB,st ރTU}&Od%.pVbw 1x}ЌnEvp H1ZP܁`RfPwnZ FN} ^: 'A ;N;&nA߅e}!'5s`Lczd72@7CD "/K\#n}*:}$*> Z*7@Sx (Z<8 }a<1 4zVGёgQ ›xKAyGZc hBW 4ի/sȋ q<̈́$q\G}={0AThH޽{2.eXU|-[tkhُ9t/hB_>@ǽq%w8nc%M5 fn(]v]%#э>iE1x =] W#PBU]OWl!I4cl8I$3;|К/TqvG5 ,Z$Q~&Sv)e{ Q8Lc?*;OGl w9ϔ Q>o@KP:Έz,`X8CG gQ~eRvST7S~w hD0 2w8-ka=fpf*?a@x1 a+Mc=q#9XK1CX_E]I)JZNݥ$$}S1I ,`9n%# 8"H# l (WQG ev>70F6dQ;ȒJ睛S:<l9S|pPx|$AO!pTSo^$+3;,#IM/?rYb:oi nUƜu)\/f6M2NFCAJ?qGSO3jʴR ;+^2 .VR.}̂ ufR o8-t@እpe'- { Ji4H=Z@hǥFRuRO*tI鞕2T\pZ9Cݎ~0ˁqY76nt|(X"(^S8KjgK5l2 V)7R1)1_)Eb["J_WDqRD UBv)*A(O+W~Csp- F"G@3,%g$KIJ$K|JT`DFIDP*!UJpHҧ.VCgoq'n;);-9N?`@ XkT 30~2Yý$4Iv*>,n)Q⒒()YR")ub)v6uZlRuQYrQ,Eo*bpuz@dIOA{}^i-.N=(>+\l&+] 2Z,q\Գ<ʣkګ]5ƢZ"]L2u\WM`LmLzI=tg@!pL+Tcs+ׁ"j_ \lCL64"~+{?`@bh%h+`Gܝt'H[LB: PȄ;~@:kEqƭwЈ䢇\P:h> }]`c8v?9go@Z J@.)pPp^'x5醿0L1d bI'c-`⸝{BN@%( kДZQAG]b'BKc^1E+}Y 1Niir,;qp<}bٳ|mir w2!GRg?>^2b@,,) P%?y"FxmChc+qfJmM}?';8X45tcs ise4,S7xvwX=,Н))"92x^e,ܶ=1B[A'cCɳ'k(w*e~ >p]^)$ms|A1$hl?8 ^ZO~GP/%^^7Ucir6Q1``M㾲 ܊=u%'4h ◬_fxAhghH$qA^áx!tzz 9mGt;hߣ%~zZygF4M{1>< 2ݓqGTe@݇Te⸛8";"q܇1MCm# i sthσ'54Uethݻ..&йg qFhq800yMD%{`1?NJ](ߗC9-8D>(}ı8.TN&mf"L[7ҋ6d1_ .-;87v\_͵(iۉcql!ı86XCoׁU|r5&ؕ~"©@p +w|o(Op?,_ %SEDRJ !d(!2ϳ2k5@s R2e&q uw{~~׽g]_8S Fټx>1Y(sZ^HBԍKÎ4$HC+PU5hD( 8̹uXы?ShiOc6إ(ZuvR@,k".s#H9ªG◆~!-sg3^̤MfN?A<11@a<WcP-=BJ;#F`jpUvTu{_L%G7\$d0-iO'xcc/xXQAFI0ņP3'aHdK{2:I!m ޫG53XmEYETE5\ Qh!+J^i6LV#;]匰RNVծ +RRʹ% ?I:LغY ZũZG Tm(W7ۊ5Lm sѧ]Vs=ՆRR$,jj-]4~YUgz^^񷜙@4b٘/9rlZSSi6wmCѫNKѳN{ѽoY%ճ]f.5Kh-6cm޸$i&h[r4/# g CO_`ެoOji KƢ)uamvGѹ0mC4+:3R{ug6C%'4?#KY3bfW<;b%;/‡b8`r>[V-0RB x:@hO>œ@#[r;A&VtÝP bydM$gnxi`"da]p4bTb€zÄJ7JEv?hgwlW\Oؤ7'~&ޅXMcPPoJk1^y \sW-$ AUgibS;8A\wPQ"Cz +nLY">(؀;D|l?ؖ ΁pp  EW#:Ԧl}nI.N+MKQ>NipʫZUCW^JVيtp%ߐ’k}@ [Y [17&?#]X۾! \o챌y)>t!GS\j2J^;KNj:$HG^N =R\-([r579et,F"a -x F.^1,Ki1 pU <\shfc&:.^٩S=Mu[pZUE_%uaX_Qo?(EŶJ#sad%V#(f*CXISUWD{^%J)+τ_-|ӵAlin=ҋ!k DWޝk^P0a*:մ&jD~X}hWkh[SX Z^-Z!4 Z1YlT <<L#ӎ~lmt{+[[]EѥN aQWj4&uuuMDۺ]Ez֢U}{Ѣ\sh9E4lUB51Mx P3VwD// $xG7?p=碧3瘢v5a.imtE+mB0bmLfi\`DE4֝$t ]=_M4=*ubNjX.VsM hX.|2=99Hh-  }4iV4nI葋e]NGP潽ZsUuDMFۢNb)u|ͰU sߐ[#`h,FBPW444 MyYW٬lk4B1rFzs2FDMâFQi:(5 DMܱp1nN ,gkw@+ ]BE ݲ.y^K}Qjj/j6bZ5zkWK(Y* > ZŖbRGb>wA-uZ1])Ak^km}ک5ȥhXCvHܱM y$.i-R?8z cІ{v$D3񏹲ƺ:,`0,h, .+N| gOVy3}Ap 1&-ٗrPz0#Ѕۂ5Vʜ\t^8o/*ԋ zsR`Ll'p ^V%{<_ox,@gЁm6JeIkIE'WӉj!N[ñQ)s# i82xGCw GzLugۂfէ: ;j4-vD[8Ɛdt\璒[C<LE``˵W(EeC=9 MoM Uo?pU~1.7m7^BZ2]!2 \ 1@/j RF4g}xUx)[2ׂQ`4qpCtx4 GALj Lا`` p01&4' )Ԓ:72-xՆ,8)I4=2) t@ClШ0􎔙uρ?k)=@g{l8Ui,nH| P%&pLp5&5Aб)MӰ˩7XKrA΍&pIe nc'ڀ:`Zn)w 8%>kXe`9+j@b q;e3 [;k4\违)&@9ܦp֍smNSx'>l%5d-bAnCN q̔!92<b &݅z@?dW )L\(.t*?AEdMr Z-KXQR;6n81CJ@^7a q'B@1 $t|䒎ƼҎw4" &¨?|aTx\z'#!48FF|M Kh6헛gcvbdv+>5{0*A2X(_[5ln:R~N}(՞<@1gMnpL"N7Gqut]_ZG-ӭdlރQ Np!Ea'viĹ[ѱhb D^1KXCl+K/ޱ !,F+Io}Fw!}@R\/ЭNZmԅZQ5Ô-|G ^0R7?,V:$;W`0Zb_kK"Bb'ޖC1΢$.iJT=2{ü/^eXIzxd|W4y34T0-*&oN"zaCy(ב<3eu6^G~zS(\ 䐆t`䀓;n&Ca4:\1 #GÈʇC8* qB)?-@{'9?hF$tGtKnKx .]H3kAhGS8Z2i Ssx,X՗rk3IOz<+9qE>K "S,9(P+پAlɃ}^kjݱ%cF7ڣ+=Ĝva4:.~p,K)(0. Lؑ?mhz&afXڍ] ̰Ng؉5XzN1`cFFc+'ckQ =68ƟB=)U0iK2 \2GR 92lt.XЂQ9wjo 2ԃϖkǼ&sMr1kNJuH+vJ-D[vuNUnr/\0R.ӅA%BzѤ>Xh|^4V*O ^)4P% ,)z:rh,Pmj4-j4k4jMkvj]&qBx1C4AU'ՓZЬ@,lOx'vpw;cxktd]L:*YuaX[SMFѫAz֢rmaBSMӜ.j-u"꧈C%Ip7X?[S`wmCO.k)FZՅ.)5dmLh6FA;Q\L=D݆BCgP'x>"Q]O*:Llx^TkP 9p ۦ16hB)ҖxF4C4:.?&=ѨPoZ565[bQi"OJjddޓn? >Ԋe|5,=o tT5EMzR UC}ҴX(53ͬB3F0VA"8FRvhʱ&@4s=2&jQnQG(Z"e3D8Ow`fyǘE)PƈK#5XcА}M"Qw(eh`;cX h t$p6;+le.m|Wpli-5eKkL@4&@}-')jco\ c1йL8٬=0#ߏi`).뱃}%һxZP0f5hrPژ.EQENYFS%8QÁT &8+Êsaõh0.p8R~&:K z$Ѱ>`gBWAp(@50`-[68 F"Ɩ7Ae4>gG':ri;>|֡:͈U k` [XBjТcb ȅihl|l^rLlHsk>7κ]AW^M2A7ܺ L:l1JD.>^4 @}y!=hNqfO Uxi*NN`( htE+:&&@pCIpJ2LHWճ`ڊ6mG>H+t$vDW=&L̚wzai(|b ~9,7"ѻGc!u֡?|tc&O0 L0 ѱ>F%9+=qBr 97 \Жq#ܧ.nL8%>S>s,K2dm H[0y%pڍLd[`nٗwZs4Ϡq:d|7+l;!(:ۑSS9:]tA’zw9 3N`X $N_ ьE1Uk4=Rp ; hp7NU}%J(o ZA 8N @ ȨƢt{(0 foު;sP<1rbrf%U3W-d`œ9N"# `Ftw`$8i)M 9l(hށq-( Kw9ĺ|3g0cO$f*"FnbUKc\0UmYi-f.2L[+@ A(W5lC fJ4@w"r q'.SUϡdOVFWg>HQ@jRyc'1gQ&"o\;jٟnemFQ8f]c i6Z&;{ߢ[dtg&UOJ.H.6l$HTe:֡Ï"ThD >Xo]ғ(P#YeV'alg S@r lXכ717j1: šַ~H(ۅ j8˓&S$:} HCr 0[VvʫO CВ@:#0|K,81rcP1[